Finds microsatellites in DNA sequences. Microsatellites are copies of simple di, tri, tetra, and pentanucleotides which lie adjacent to each other. For example the sequence ACGTACGTACGTACGTACGT is a microsatellite repeat of tetranucleotide ACGT.
1. Sequence (Paste the raw sequence, not fasta format):
Full length:0
About microsatellite repeats
A microsatellite is a tract of repetitive DNA in which certain DNA motifs (ranging in length from one to six or more base pairs) are repeated, typically 5–50 times. Microsatellites occur at thousands of locations within an organism's genome. They have a higher mutation rate than other areas of DNA leading to high genetic diversity. Microsatellites are often referred to as short tandem repeats (STRs) by forensic geneticists and in genetic genealogy, or as simple sequence repeats (SSRs) by plant geneticists.
Microsatellites and their longer cousins, the minisatellites, together are classified as VNTR (variable number of tandem repeats) DNA. The name "satellite" DNA refers to the early observation that centrifugation of genomic DNA in a test tube separates a prominent layer of bulk DNA from accompanying "satellite" layers of repetitive DNA.
They are widely used for DNA profiling in cancer diagnosis, in kinship analysis (especially paternity testing) and in forensic identification. They are also used in genetic linkage analysis to locate a gene or a mutation responsible for a given trait or disease. Microsatellites are also used in population genetics to measure levels of relatedness between subspecies, groups and individuals.