Cart 2

AAVS1-Blasticidin-CAG-Flpe-ERT2 vector (V010517#)

Basic Vector Information

Basic Vector Information
Vector Name AAVS1-Blasticidin-CAG-Flpe-ERT2 Antibiotic Resistance Ampicillin
Length 12382 bp Type Mammalian Expression, Synthetic Biology
Selection Marker Blasticidin Copy Number High Copy
Promoter CAG Cloning Method Restriction Enzyme
5' Primer ggcttctggcgtgtgaccggc 3' Primer catagcgtaaaaggagcaaca

AAVS1-Blasticidin-CAG-Flpe-ERT2 vector Vector Map

HA-L SA T2A BGH-rev CMV enhancer chicken beta-actin promoter chimeric intron pCAG-F Kozak sequence ERT2 WPRE hGH poly(A) signal Bglob-pA-R beta-globin poly(A) signal M13 rev lac operator lac promoter CAP binding site HA-R T7 M13 Forward ccdB Neo-R Neo-F AmpR ori L4440 CAP binding site lac promoter lac operator M13 rev T3 promoter

Plasmid Resuspension protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

AAVS1-Blasticidin-CAG-Flpe-ERT2 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported               12382 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  AAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and
            blasticidin selection gene.
KEYWORDS    AAVS1-Blasticidin-CAG-Flpe-ERT2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 12382)
  AUTHORS   Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, 
            Zhang SC
  TITLE     Engineering Human Stem Cell Lines with Inducible Gene Knockout using
  JOURNAL   Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 
  PUBMED    26145478
REFERENCE   2  (bases 1 to 12382)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Cell Stem 
            Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 
FEATURES             Location/Qualifiers
     source          1..12382
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    33..836
                     /note="left homology arm from the adeno-associated virus 
                     integration site (AAVS1) within intron 1 of the human 
                     PPP1R12C gene"
     misc_feature    843..868
                     /note="splice acceptor site"
     CDS             892..945
                     /product="2A peptide from Thosea asigna virus capsid 
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
     primer_bind     complement(1418..1435)
                     /note="Bovine growth hormone terminator, reverse primer. 
                     Also called BGH reverse"
     polyA_signal    1424..1648
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     enhancer        1716..2095
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        2097..2374
                     /label=chicken beta-actin promoter
     intron          2376..3393
                     /label=chimeric intron
                     /note="chimera between introns from chicken beta-actin and 
                     rabbit beta-globin"
     primer_bind     3317..3339
                     /note="Chimeric intron in CAG promoter, forward primer"
     primer_bind     3401..3420
                     /note="Rabbit beta-globin intron, for pCAG plasmids, 
                     forward primer"
     regulatory      3457..3466
                     /label=Kozak sequence
                     /note="vertebrate consensus sequence for strong initiation 
                     of translation (Kozak, 1987)"
     CDS             4762..5697
                     /product="mutated ligand-binding domain of the human 
                     estrogen receptor (Feil et al., 1997)"
     misc_feature    5737..6325
                     /note="woodchuck hepatitis virus posttranscriptional 
                     regulatory element"
     primer_bind     complement(5790..5810)
                     /note="WPRE, reverse primer"
     CDS             complement(6208..6219)
                     /product="Factor Xa recognition and cleavage site"
                     /label=Factor Xa site
     polyA_signal    6357..6833
                     /label=hGH poly(A) signal
                     /note="human growth hormone polyadenylation signal"
     primer_bind     complement(6556..6575)
                     /note="Human growth hormone terminator, reverse primer"
     primer_bind     complement(6943..6962)
                     /note="Rabbit beta-globin polyA region, reverse primer"
     polyA_signal    7008..7063
                     /label=beta-globin poly(A) signal
                     /note="rabbit beta-globin polyadenylation signal (Gil and 
                     Proudfoot, 1987)"
     primer_bind     complement(7062..7081)
                     /note="Rabbit beta-globin polyA, reverse primer. Also 
                     called rb-glob-pA-term-R"
     primer_bind     complement(7424..7440)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
     protein_bind    7448..7464
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(7472..7502)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    7517..7538
                     /label=CAP binding site
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     misc_feature    7612..8448
                     /note="right homology arm from the adeno-associated virus 
                     integration site (AAVS1) within intron 1 of the human 
                     PPP1R12C gene"
     primer_bind     complement(8488..8507)
                     /note="T7 promoter, forward primer"
     promoter        complement(8489..8507)
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(8514..8531)
                     /label=M13 Forward
                     /note="In lacZ gene. Also called M13-F20 or M13 (-21) 
     primer_bind     complement(8514..8530)
                     /label=M13 fwd
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(8523..8545)
                     /label=M13/pUC Forward
                     /note="In lacZ gene"
     CDS             8668..8970
                     /product="CcdB, a bacterial toxin that poisons DNA gyrase"
                     /note="Plasmids containing the ccdB gene cannot be 
                     propagated in standard E. coli strains."
     primer_bind     8849..8868
                     /note="ccdB gene, forward primer"
     primer_bind     complement(9373..9392)
                     /note="Neomycin resistance gene, reverse primer"
     primer_bind     9987..10006
                     /note="Neomycin resistance gene, forward primer"
     CDS             complement(10367..11227)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     10990..11009
                     /note="Ampicillin resistance gene, reverse primer"
     rep_origin      11351..11939
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     11840..11859
                     /note="pBR322 origin, forward primer"
     primer_bind     12093..12110
                     /note="L4440 vector, forward primer"
     protein_bind    12227..12248
                     /label=CAP binding site
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        12263..12293
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    12301..12317
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     12325..12341
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
     promoter        12362..12380
                     /label=T3 promoter
                     /note="promoter for bacteriophage T3 RNA polymerase"

This page is informational only.