AAVS1-Blasticidin-CAG-Flpe-ERT2 vector (Cat. No.: V010517)
- Name:
- AAVS1-Blasticidin-CAG-Flpe-ERT2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12382 bp
- Type:
- Mammalian Expression, Synthetic Biology
- Replication origin:
- ori
- Selection Marker:
- Blasticidin
- Copy Number:
- High Copy
- Promoter:
- CAG
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- ggcttctggcgtgtgaccggc
- 3' Primer:
- catagcgtaaaaggagcaaca
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
AAVS1-Blasticidin-CAG-Flpe-ERT2 vector (Cat. No.: V010517) Sequence
LOCUS V010517 12382 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V010517
VERSION V010517
KEYWORDS AAVS1-Blasticidin-CAG-Flpe-ERT2
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12382)
AUTHORS Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z,
Zhang SC
TITLE Engineering Human Stem Cell Lines with Inducible Gene Knockout using
CRISPR/Cas9.
JOURNAL Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi:
10.1016/j.stem.2015.06.001.
PUBMED 26145478
REFERENCE 2 (bases 1 to 12382)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12382)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cell Stem
Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi:
10.1016/j.stem.2015.06.001."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12382
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 33..836
/label="HA-L"
/note="left homology arm from the adeno-associated virus
integration site (AAVS1) within intron 1 of the human
PPP1R12C gene"
misc_feature 843..868
/label="SA"
/note="splice acceptor site"
CDS 892..945
/label="T2A"
/note="2A peptide from Thosea asigna virus capsid protein"
CDS 955..1374
/gene="bsr"
/label="Blasticidin-S deaminase"
/note="Blasticidin-S deaminase from Bacillus cereus.
Accession#: P33967"
polyA_signal 1424..1648
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
enhancer 1716..2095
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 2097..2374
/label="chicken beta-actin promoter"
intron 2376..3393
/label="chimeric intron"
/note="chimera between introns from chicken beta-actin and
rabbit beta-globin"
primer_bind 3401..3420
/label="pCAG-F"
/note="Rabbit beta-globin intron, for pCAG plasmids,
forward primer"
regulatory 3457..3466
/label="Kozak sequence"
/note="vertebrate consensus sequence for strong initiation
of translation (Kozak, 1987)"
/regulatory_class="other"
CDS 3469..4737
/label="FLPo"
/note="nuclear-targeted site-specific recombinase"
CDS 4762..5697
/label="ERT2"
/note="mutated ligand-binding domain of the human estrogen
receptor (Feil et al., 1997)"
misc_feature 5737..6325
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
polyA_signal 6357..6833
/label="hGH poly(A) signal"
/note="human growth hormone polyadenylation signal"
primer_bind complement(6943..6962)
/label="Bglob-pA-R"
/note="Rabbit beta-globin polyA region, reverse primer"
polyA_signal 7008..7063
/label="beta-globin poly(A) signal"
/note="rabbit beta-globin polyadenylation signal (Gil and
Proudfoot, 1987)"
primer_bind complement(7062..7081)
/label="rbglobpA-R"
/note="Rabbit beta-globin polyA, reverse primer. Also
called rb-glob-pA-term-R"
primer_bind complement(7424..7440)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind 7448..7464
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(7472..7502)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(7517..7538)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
misc_feature 7612..8448
/label="HA-R"
/note="right homology arm from the adeno-associated virus
integration site (AAVS1) within intron 1 of the human
PPP1R12C gene"
promoter complement(8489..8507)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(8514..8531)
/label="M13 Forward"
/note="In lacZ gene. Also called M13-F20 or M13 (-21)
Forward"
primer_bind complement(8514..8530)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8523..8545)
/label="M13/pUC Forward"
/note="In lacZ gene"
CDS 8668..8967
/label="ccdB"
/note="CcdB, a bacterial toxin that poisons DNA gyrase"
primer_bind complement(9373..9392)
/label="Neo-R"
/note="Neomycin resistance gene, reverse primer"
primer_bind 9987..10006
/label="Neo-F"
/note="Neomycin resistance gene, forward primer"
CDS complement(10370..11227)
/label="AmpR"
/note="beta-lactamase"
rep_origin 11351..11939
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 12093..12110
/label="L4440"
/note="L4440 vector, forward primer"
protein_bind 12227..12248
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 12263..12293
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 12301..12317
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 12325..12341
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
promoter 12362..12380
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"