pYD1 vector (Cat. No.: V012745)

pYD15009 bp6001200180024003000360042004800GAL1 promoterT7 promoterAGA2leader peptide from bacteriophage T7 gene 10Xpress(TM) tagV5 tag6xHisTRP1TRP1 promoterCEN/ARSAmpR promoterAmpRoriCAP binding sitelac promoterlac operatorM13 revT3 promoter
Basic Information

Note: pYD1 is a 5.0 kb expression vector designed for expression, secretion, and display of proteins on the extracellular surface of Saccharomyces cerevisiae cells. The vector contains the following elements:

1. AGA2 gene from Saccharomyces cerevisiae. This gene encodes one of the subunits of the a-agglutinin receptor. Fusion of the gene of interest to AGA2 allows secretion and display of the protein of interest.

2. GAL1 promoter for regulated expression of the AGA2 gene fusion.

3. Xpress epitope and V5 epitope for detection of the displayed protein.

4. Polyhistidine (6xHis) tag for detection and possible purification on metal chelating resin.

5. TRP1 gene for selection in Saccharomyces cerevisiae.

6. CEN6/ARS4 for stable, episomal replication in yeast.

7. Ampicillin resistance gene and the pUC origin for selection and replication in E. coli.

Name:
pYD1
Antibiotic Resistance:
Ampicillin
Length:
5009 bp
Type:
Yeast Plasmids
Replication origin:
ori
Source/Author:
Invitrogen
Selection Marker:
TRP1
Copy Number:
High copy number
Promoter:
GAL1
Cloning Method:
Enzyme Cut
5' Primer:
pYD1-F: AGTAACGTTTGTCAGTAATTGC
3' Primer:
pYD1-R: GTCGATTTTGTTACATCTACAC
Growth Strain(s):
DH10B
Growth Temperature:
37℃
$ 397.9
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Yang YY, Zheng SY, Fang H, Wu XM, Zhang J, Chang MX. Immunoprotective Effects of Two Histone H2A Variants in the Grass Carp Against Flavobacterium columnare Infection. Front Immunol. 2022 Jul 11;13:939464.

pYD1 vector (Cat. No.: V012745) Sequence

LOCUS       Exported                5009 bp DNA     circular SYN 03-SEP-2024
DEFINITION  Exported.
ACCESSION   V012745
VERSION     .
KEYWORDS    pYD1
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 5009)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 5009)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 5009)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..5009
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        2..443
                     /label=GAL1 promoter
                     /note="inducible promoter, regulated by Gal4"
     promoter        475..493
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             536..796
                     /gene="AGA2"
                     /label=A-agglutinin-binding subunit
                     /note="A-agglutinin-binding subunit from Saccharomyces 
                     cerevisiae (strain ATCC 204508 / S288c). Accession#: 
                     P32781"
     CDS             860..889
                     /codon_start=1
                     /product="leader peptide from bacteriophage T7 gene 10"
                     /label=leader peptide from bacteriophage T7 gene 10
                     /note="T7 tag (gene 10 leader)"
                     /note="promotes efficient translation in E. coli"
                     /translation="ASMTGGQQMG"
     CDS             893..916
                     /label=Xpress(TM) tag
                     /note="Xpress(TM) epitope tag, including an enterokinase 
                     recognition and cleavage site"
     CDS             995..1036
                     /label=V5 tag
                     /note="epitope tag from simian virus 5"
     CDS             1046..1063
                     /label=6xHis
                     /note="6xHis affinity tag"
     CDS             complement(1437..2108)
                     /label=TRP1
                     /note="phosphoribosylanthranilate isomerase, required for 
                     tryptophan biosynthesis"
     promoter        complement(2109..2210)
                     /label=TRP1 promoter
     misc_feature    complement(2287..2790)
                     /label=CEN/ARS
                     /note="S. cerevisiae CEN6 centromere fused to an
                     autonomously replicating sequence"
     promoter        2827..2931
                     /label=AmpR promoter
     CDS             2932..3789
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      3963..4551
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     protein_bind    4839..4860
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4875..4905
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    4913..4929
                     /label=lac operator
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4937..4953
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     promoter        4974..4992
                     /label=T3 promoter
                     /note="promoter for bacteriophage T3 RNA polymerase"