pLenti4/V5-GW/lacZ vector (V011372)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V011372 pLenti4/V5-GW/lacZ In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pLenti4/V5-GW/lacZ
Antibiotic Resistance:
Ampicillin
Length:
10073 bp
Type:
Lentiviral vectors
Replication origin:
ori
Selection Marker:
Zeocin
Promoter:
SV40
Cloning Method:
Gateway
5' Primer:
CMVPro Fwd: 5'd[CGCAAATGGGCGGTAGGCGTG]3'
Fusion Tag:
V5

pLenti4/V5-GW/lacZ vector Map

pLenti4/V5-GW/lacZ10073 bp50010001500200025003000350040004500500055006000650070007500800085009000950010000attB2V5 tagSV40 promoterEM7 promoterBleoR3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterf1 oriAmpR promoterAmpRoriCAP binding sitelac promoterT3 promoterRSV promoterHIV-1 PsiRREgp41 peptideProtein TatCMV enhancerCMV promoterattB1lacZ

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLenti4/V5-GW/lacZ vector Sequence

LOCUS       V011372                10073 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V011372
VERSION     V011372
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 10073)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 10073)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10073
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     protein_bind    complement(811..835)
                     /label="attB2"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             888..929
                     /label="V5 tag"
                     /note="epitope tag from simian virus 5"
     promoter        971..1300
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        1312..1359
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             1378..1749
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     LTR             1845..2078
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    2150..2284
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      2311..2446
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(2467..2485)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     rep_origin      2653..3108
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        3134..3238
                     /label="AmpR promoter"
     CDS             3239..4096
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      4270..4858
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     protein_bind    5146..5167
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        5182..5212
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     promoter        5281..5299
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        5327..5553
                     /label="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     misc_feature    5781..5906
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    6399..6632
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             6817..6861
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             7010..7051
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     enhancer        7140..7443
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        7444..7647
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     protein_bind    7764..7788
                     /label="attB1"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             join(7820..10073,1..791)
                     /label="lacZ"
                     /note="beta-galactosidase"