Basic Vector Information
- Vector Name:
- pShuttle-CMV-lacZ
- Antibiotic Resistance:
- Kanamycin
- Length:
- 10660 bp
- Type:
- Adenoviral vectors
- Replication origin:
- ori
- Copy Number:
- Low copy number
- Promoter:
- CMV
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- pShuttle-CMV-F: GGTCTATATAAGCAGAGCTG
- 3' Primer:
- pShuttle-CMV-R: GTGGTATGGCTGATTATGATCAG
pShuttle-CMV-lacZ vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pShuttle-CMV-lacZ vector Sequence
LOCUS 40924_40137 10660 bp DNA circular SYN 13-JAN-2022 DEFINITION synthetic circular DNA. ACCESSION . VERSION . KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 10660) TITLE Direct Submission REFERENCE 2 (bases 1 to 10660) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..10660 /mol_type="other DNA" /organism="synthetic DNA construct" repeat_region 1..103 /label=ITR /note="inverted terminal repeat of human adenovirus serotype 5" misc_signal 191..340 /label=Ad5 Psi /note="packaging signal for adenovirus serotype 5" enhancer 398..701 /label=CMV enhancer /note="human cytomegalovirus immediate early enhancer" promoter 702..905 /label=CMV promoter /note="human cytomegalovirus (CMV) immediate early promoter" CDS 970..4014 /label=lacZ /note="beta-galactosidase" polyA_signal 4323..4444 /label=SV40 poly(A) signal /note="SV40 polyadenylation signal" CDS 4527..4946 /gene="IX" /label=IX /note="Hexon-interlacing protein from Human adenovirus C serotype 5. Accession#: P03281" CDS complement(5012..6346) /gene="IVa2" /label=IVa2 /note="Packaging protein 1 from Human adenovirus C serotype 5. Accession#: P03271" repeat_region 7620..7722 /label=ITR /note="inverted terminal repeat of human adenovirus serotype 5" rep_origin complement(7982..8570) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS 9402..10193 /label=NeoR/KanR /note="aminoglycoside phosphotransferase" rep_origin complement(10244..10623) /direction=LEFT /label=M13 ori /note="M13 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis"
This page is informational only.