pShuttle-CMV-lacZ vector (V001805)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V001805 pShuttle-CMV-lacZ In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pShuttle-CMV-lacZ
Antibiotic Resistance:
Kanamycin
Length:
10660 bp
Type:
Adenoviral vectors
Replication origin:
ori
Copy Number:
Low copy number
Promoter:
CMV
Cloning Method:
Enzyme digestion and ligation
5' Primer:
pShuttle-CMV-F: GGTCTATATAAGCAGAGCTG
3' Primer:
pShuttle-CMV-R: GTGGTATGGCTGATTATGATCAG

pShuttle-CMV-lacZ vector Map

pShuttle-CMV-lacZ10660 bp5001000150020002500300035004000450050005500600065007000750080008500900095001000010500ITRAd5 PsiCMV enhancerCMV promoterlacZSV40 poly(A) signalHexon-interlacing proteinPackaging protein 1ITRoriNeoR/KanRM13 ori

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pShuttle-CMV-lacZ vector Sequence

LOCUS       V001805                10660 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V001805
VERSION     V001805
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 10660)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 10660)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10660
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     repeat_region   1..103
                     /label="ITR"
                     /note="inverted terminal repeat of human adenovirus
                     serotype 5"
     misc_signal     191..340
                     /label="Ad5 Psi"
                     /note="packaging signal for adenovirus serotype 5"
     enhancer        398..701
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        702..905
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     CDS             970..4014
                     /label="lacZ"
                     /note="beta-galactosidase"
     polyA_signal    4323..4444
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     CDS             4527..4946
                     /gene="IX"
                     /label="Hexon-interlacing protein"
                     /note="Hexon-interlacing protein from Human adenovirus C
                     serotype 5. Accession#: P03281"
     CDS             complement(5012..6346)
                     /gene="IVa2"
                     /label="Packaging protein 1"
                     /note="Packaging protein 1 from Human adenovirus C serotype
                     5. Accession#: P03271"
     repeat_region   7620..7722
                     /label="ITR"
                     /note="inverted terminal repeat of human adenovirus
                     serotype 5"
     rep_origin      complement(7982..8570)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             9402..10193
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     rep_origin      complement(10244..10623)
                     /direction=LEFT
                     /label="M13 ori"
                     /note="M13 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"