pMT-1 vector (Cat. No.: V016540)

pMT-17541 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600690072007500repeat_regionCMV enhancerCMV promoterCuOKozak consensus sequence; vertebrate consensus sequence for strong initiation of translationsig_peptidecodAuppIRES2EGFPSV40 poly(A) signalf1 oriAmpR promoterSV40 promoterNeoR/KanRHSV TK poly(A) signalori
Basic Information
Name:
pMT-1
Antibiotic Resistance:
Kanamycin
Length:
7541 bp
Type:
Expression vector
Replication origin:
ori
Source/Author:
Taghavi M, Parham A, Dehghani H, Naderi-Meshkin H.

pMT-1 vector (Cat. No.: V016540) Sequence

LOCUS       V016540                 7541 bp    DNA     circular SYN 29-JAN-2020
DEFINITION  Exported.
ACCESSION   V016540
VERSION     V016540
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7541)
  AUTHORS   Taghavi M, Parham A, Dehghani H, Naderi-Meshkin H.
  TITLE     Direct Submission
  JOURNAL   Submitted (04-OCT-2019) Department of Basic Sciences, Faculty of
            Veterinary Medicine, Ferdowsi University of Mashhad, Azadi Square,
            Mashhad, Razavi Khorasan 91779-48974, Iran
REFERENCE   2  (bases 1 to 7541)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     ##Assembly-Data-START##
            Sequencing Technology :: Sanger dideoxy sequencing
            ##Assembly-Data-END##
            SGRef: number: 1; type: "Journal Article"; journalName: "Submitted
            (04-OCT-2019) Department of Basic Sciences, Faculty of Veterinary
            Medicine, Ferdowsi University of Mashhad, Azadi Square, Mashhad,
            Razavi Khorasan 91779-48974, Iran"
FEATURES             Location/Qualifiers
     source          1..7541
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     repeat_region   29..172
                     /rpt_unit_range=29 .. 52
                     /rpt_unit_seq="cacacgtgggttcccgcacgtccg"
     regulatory      29..172
                     /label="sextuplicate hypoxia-response element"
                     /note="sextuplicate hypoxia-response element"
                     /regulatory_class="response_element"
     enhancer        185..488
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        499..702
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     protein_bind    740..767
                     /label="CuO"
                     /note="CymR-binding P2 operator sequence from the p-cmt
                     operon of Pseudomonas putida (Mullick et al., 2006)"
     regulatory      798..815
                     /note="Kozak consensus sequence; vertebrate consensus
                     sequence for strong initiation of translation"
                     /regulatory_class="ribosome_binding_site"
     sig_peptide     816..920
     CDS             936..2216
                     /label="codA"
                     /note="E. coli cytosine deaminase"
     CDS             2244..2864
                     /gene="upp"
                     /label="Uracil phosphoribosyltransferase"
                     /note="Uracil phosphoribosyltransferase from Escherichia
                     coli O139:H28 (strain E24377A / ETEC). Accession#: A7ZPU1"
     misc_feature    2900..3486
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             3487..4203
                     /label="EGFP"
                     /note="enhanced GFP"
     polyA_signal    4329..4450
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(4457..4912)
                     /direction=LEFT
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        4939..5043
                     /label="AmpR promoter"
     promoter        5045..5402
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             5437..6228
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     polyA_signal    6463..6510
                     /label="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      6839..7427
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"

This page is informational only.