pMT-6 vector (V015674)

LOCUS       V015674                 7014 bp    DNA     circular SYN 10-JUL-2020
DEFINITION  Exported.
ACCESSION   V015674
VERSION     V015674
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7014)
  AUTHORS   Taghavi M, Parham A, Dehghani H, Naderi-Meshkin H.
  TITLE     Direct Submission
  JOURNAL   Submitted (17-FEB-2020) Department of Basic Sciences, Faculty of
            Veterinary Medicine, Ferdowsi University of Mashhad, Azadi Square,
            Mashhad, Razavi Khorasan 91779-48974, Iran
REFERENCE   2  (bases 1 to 7014)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     ##Assembly-Data-START##
            Sequencing Technology :: Sanger dideoxy sequencing
            ##Assembly-Data-END##
            SGRef: number: 1; type: "Journal Article"; journalName: "Submitted
            (17-FEB-2020) Department of Basic Sciences, Faculty of Veterinary
            Medicine, Ferdowsi University of Mashhad, Azadi Square, Mashhad,
            Razavi Khorasan 91779-48974, Iran"
FEATURES             Location/Qualifiers
     source          1..7014
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     repeat_region   29..172
                     /rpt_family="response_element"
                     /rpt_unit_range=29 .. 52
                     /rpt_unit_seq="cacacgtgggttcccgcacgtccg"
     regulatory      29..172
                     /label="sextuplicate hypoxia-response element"
                     /note="sextuplicate hypoxia-response element"
                     /regulatory_class="response_element"
     protein_bind    213..240
                     /label="CuO"
                     /note="CymR-binding P2 operator sequence from the p-cmt
                     operon of Pseudomonas putida (Mullick et al., 2006)"
     regulatory      271..288
                     /note="Kozak consensus sequence; vertebrate consensus
                     sequence for strong initiation of translation"
                     /regulatory_class="ribosome_binding_site"
     sig_peptide     289..393
                     /note="tPA prepro (secretory signal peptide)"
     CDS             409..1689
                     /label="codA"
                     /note="E. coli cytosine deaminase"
     CDS             1717..2337
                     /gene="upp"
                     /label="Uracil phosphoribosyltransferase"
                     /note="Uracil phosphoribosyltransferase from Escherichia
                     coli O139:H28 (strain E24377A / ETEC). Accession#: A7ZPU1"
     misc_feature    2373..2959
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             2960..3676
                     /label="EGFP"
                     /note="enhanced GFP"
     polyA_signal    3802..3923
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(3930..4385)
                     /direction=LEFT
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        4412..4516
                     /label="AmpR promoter"
     promoter        4518..4875
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             4910..5701
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     polyA_signal    5936..5983
                     /label="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      6312..6900
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"