pLJC5-Tmem192-3xHA vector (Cat. No.: V014664)
Note: pLJC5-Tmem192-3xHA is a lentiviral transfer plasmid engineered to express TMEM192-3×HA fusion protein. It enables stable expression in host cells, facilitating lysosome labeling, protein interaction analysis and LysoIP-based lysosome purification.
- Name:
- pLJC5-Tmem192-3xHA
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8954 bp
- Type:
- Protein expression
- Replication origin:
- ori
- Host:
- Mammalian cells, Lentivirus
- Selection Marker:
- Puro
- Promoter:
- UbC
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- CGAAGGAATAGAAGAAGAAGGTGGAGA
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Abu-Remaileh M, Wyant GA, Kim C, Laqtom NN, Abbasi M, Chan SH, Freinkman E, Sabatini DM. Lysosomal metabolomics reveals V-ATPase- and mTOR-dependent regulation of amino acid efflux from lysosomes. Science. 2017 Nov 10;358(6364):807-813. doi: 10.1126/science.aan6298. Epub 2017 Oct 26. PMID: 29074583; PMCID: PMC5704967.
pLJC5-Tmem192-3xHA vector (Cat. No.: V014664) Sequence
LOCUS V014664 8954 bp DNA circular SYN 01-JAN-1980
DEFINITION Exported.
ACCESSION V014664
VERSION V014664
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 8954)
AUTHORS .
TITLE Direct Submission
FEATURES Location/Qualifiers
source 1..8954
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 1..227
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 228..408
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 455..580
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1073..1306
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1491..1535
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1684..1725
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
promoter 1824..3035
/label="UbC promoter"
/note="human ubiquitin C promoter"
CDS 3059..3871
/gene="TMEM192"
/label="Transmembrane protein 192"
/note="Transmembrane protein 192 from Homo sapiens.
Accession#: Q8IY95"
CDS 3887..3913
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
CDS 3926..3952
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
CDS 3965..3991
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
misc_feature 4048..4165
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 4214..4724
/label="hPGK promoter"
/note="human phosphoglycerate kinase 1 promoter"
CDS 4746..5342
/label="PuroR"
/note="puromycin N-acetyltransferase"
LTR 5473..5706
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 5778..5912
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 5939..6074
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(6095..6113)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(6123..6139)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 6281..6736
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 6762..6866
/label="AmpR promoter"
CDS 6867..7724
/label="AmpR"
/note="beta-lactamase"
rep_origin 7898..8486
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
protein_bind 8774..8795
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 8810..8840
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 8848..8864
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 8872..8888
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
promoter 8909..8927
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"