pLJC5-Tmem192-3xHA vector (Cat. No.: V014664)

pLJC5-Tmem192-3xHA8954 bp40080012001600200024002800320036004000440048005200560060006400680072007600800084008800RSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatUbC promoterTMEM192HAHAHAcPPT/CTShPGK promoterPuroR3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterM13 fwdf1 oriAmpR promoterAmpRoriCAP binding sitelac promoterlac operatorM13 revT3 promoter
Basic Information

Note: pLJC5-Tmem192-3xHA is a lentiviral transfer plasmid engineered to express TMEM192-3×HA fusion protein. It enables stable expression in host cells, facilitating lysosome labeling, protein interaction analysis and LysoIP-based lysosome purification.

Name:
pLJC5-Tmem192-3xHA
Antibiotic Resistance:
Ampicillin
Length:
8954 bp
Type:
Protein expression
Replication origin:
ori
Host:
Mammalian cells, Lentivirus
Selection Marker:
Puro
Promoter:
UbC
Cloning Method:
Restriction Enzyme
5' Primer:
CGAAGGAATAGAAGAAGAAGGTGGAGA
Growth Strain(s):
stbl3
Growth Temperature:
37℃
$ 198.8
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Abu-Remaileh M, Wyant GA, Kim C, Laqtom NN, Abbasi M, Chan SH, Freinkman E, Sabatini DM. Lysosomal metabolomics reveals V-ATPase- and mTOR-dependent regulation of amino acid efflux from lysosomes. Science. 2017 Nov 10;358(6364):807-813. doi: 10.1126/science.aan6298. Epub 2017 Oct 26. PMID: 29074583; PMCID: PMC5704967.

pLJC5-Tmem192-3xHA vector (Cat. No.: V014664) Sequence

LOCUS       V014664                 8954 bp    DNA     circular SYN 01-JAN-1980
DEFINITION  Exported.
ACCESSION   V014664
VERSION     V014664
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8954)
  AUTHORS   .
  TITLE     Direct Submission
FEATURES             Location/Qualifiers
     source          1..8954
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        1..227
                     /label="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             228..408
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    455..580
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1073..1306
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1491..1535
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             1684..1725
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     promoter        1824..3035
                     /label="UbC promoter"
                     /note="human ubiquitin C promoter"
     CDS             3059..3871
                     /gene="TMEM192"
                     /label="Transmembrane protein 192"
                     /note="Transmembrane protein 192 from Homo sapiens.
                     Accession#: Q8IY95"
     CDS             3887..3913
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     CDS             3926..3952
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     CDS             3965..3991
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     misc_feature    4048..4165
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        4214..4724
                     /label="hPGK promoter"
                     /note="human phosphoglycerate kinase 1 promoter"
     CDS             4746..5342
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     LTR             5473..5706
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    5778..5912
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      5939..6074
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(6095..6113)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(6123..6139)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     rep_origin      6281..6736
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        6762..6866
                     /label="AmpR promoter"
     CDS             6867..7724
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      7898..8486
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     protein_bind    8774..8795
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        8810..8840
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    8848..8864
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     8872..8888
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        8909..8927
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"