pTet-PLKO-puro vector (V004043)

Basic Vector Information

3rd generation lentiviral plasmid for inducible expression of shRNA; puromycin selection

Vector Name:
pTet-PLKO-puro
Antibiotic Resistance:
Ampicillin
Length:
10633 bp
Type:
Lentiviral vectors
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
Low copy number
Promoter:
hPGK
5' Primer:
GGCAGGGATATTCACCATTATCGTTTCAGA

pTet-PLKO-puro vector Vector Map

pTet-PLKO-puro10633 bp5001000150020002500300035004000450050005500600065007000750080008500900095001000010500hPGK promoterbeta-globin intronT7 promoterTetRIRESPuroR3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterM13 fwdf1 oriAmpR promoterAmpRoriCAP binding sitelac promoterlac operatorM13 revT3 promoterRSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509H1-2O2 promoterhPGK promoter

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

pTet-PLKO-puro vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       40924_43014       10633 bp DNA     circular SYN 13-JAN-2022
DEFINITION  synthetic circular DNA.
ACCESSION   .
VERSION     .
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 10633)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 10633)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10633
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        7..507
                     /label=hPGK promoter
                     /note="human phosphoglycerate kinase 1 promoter"
     intron          516..1088
                     /label=beta-globin intron
                     /note="intron from rabbit beta-globin gene"
     promoter        1143..1161
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             1172..1792
                     /label=TetR
                     /note="tetracycline repressor TetR"
     misc_feature    1827..2400
                     /label=IRES
                     /note="internal ribosome entry site (IRES) of the 
                     encephalomyocarditis virus (EMCV)"
     CDS             2420..3016
                     /label=PuroR
                     /note="puromycin N-acetyltransferase"
     LTR             3147..3380
                     /label=3' LTR (Delta-U3)
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    3452..3586
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     rep_origin      3613..3748
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     promoter        complement(3769..3787)
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(3797..3813)
                     /label=M13 fwd
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     rep_origin      3955..4410
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        4436..4540
                     /label=AmpR promoter
     CDS             4541..5398
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      5572..6160
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     protein_bind    6448..6469
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        6484..6514
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    6522..6538
                     /label=lac repressor encoded by lacI binding site
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     6546..6562
                     /label=M13 rev
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     promoter        6583..6601
                     /label=T3 promoter
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        6629..6855
                     /label=RSV promoter
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             6856..7036
                     /label=5' LTR (truncated)
                     /note="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    7083..7208
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    7701..7934
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             8119..8163
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             8312..8353
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     promoter        8452..8546
                     /label=H1-2O2 promoter
                     /note="doxycycline-inducible variant of the human H1 RNA 
                     promoter (Henriksen et al., 2007)"
     promoter        10000..10507
                     /label=hPGK promoter
                     /note="human phosphoglycerate kinase 1 promoter"

This page is informational only.