pHoss1 vector (V000841)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V000841 pHoss1 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pHoss1
Antibiotic Resistance:
Ampicillin
Length:
8859 bp
Type:
Suicide plasmid for Gram-positive bacteria
Replication origin:
ori
Selection Marker:
Erythromycin
Cloning Method:
Restriction Enzyme
5' Primer:
GATCTAATGATTCAAACCCTTGTG
3' Primer:
TGAAGTTACCATCACGGAAAAAGG

pHoss1 vector Map

pHoss18859 bp40080012001600200024002800320036004000440048005200560060006400680072007600800084008800rRNA adenine N-6-methyltransferasePlasmid recombination enzyme type 1TetRtet operatortet operatorropbomL4440oriAmpRAmpR promoterpBRforEco

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pHoss1 vector Sequence

LOCUS       V000841                 8859 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000841
VERSION     V000841
KEYWORDS    pHoss1
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8859)
  AUTHORS   Abdelhamed H, Lawrence ML, Karsi A
  TITLE     A novel suicide plasmid for efficient gene mutation in Listeria
            monocytogenes.
  JOURNAL   Plasmid. 2015 May 31;81:1-8. doi: 10.1016/j.plasmid.2015.05.003.
   PUBMED   26038185
REFERENCE   2  (bases 1 to 8859)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 8859)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Plasmid.";
            date: "2015-05-31"; pages: "
            10.1016/j.plasmid.2015.05.003"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8859
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             complement(98..829)
                     /gene="ermC"
                     /label="rRNA adenine N-6-methyltransferase"
                     /note="rRNA adenine N-6-methyltransferase from
                     Staphylococcus aureus. Accession#: P02979"
     CDS             1241..2449
                     /gene="pre"
                     /label="Plasmid recombination enzyme type 1"
                     /note="Plasmid recombination enzyme type 1 from
                     Staphylococcus aureus. Accession#: P03857"
     CDS             complement(4072..4695)
                     /label="TetR"
                     /note="tetracycline repressor TetR"
     protein_bind    4717..4735
                     /label="tet operator"
                     /note="bacterial operator O1 for the tetR and tetA genes"
     protein_bind    4802..4820
                     /label="tet operator"
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O1 for the tetR and tetA genes"
     CDS             6416..6604
                     /label="rop"
                     /note="Rop protein, which maintains plasmids at low copy
                     number"
     primer_bind     complement(6601..6623)
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     misc_feature    6709..6849
                     /label="bom"
                     /note="basis of mobility region from pBR322"
     primer_bind     complement(6864..6881)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(7035..7623)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(7797..8654)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(8655..8759)
                     /label="AmpR promoter"
     primer_bind     8827..8845
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"