Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V000841 | pHoss1 | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pHoss1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8859 bp
- Type:
- Suicide plasmid for Gram-positive bacteria
- Replication origin:
- ori
- Selection Marker:
- Erythromycin
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GATCTAATGATTCAAACCCTTGTG
- 3' Primer:
- TGAAGTTACCATCACGGAAAAAGG
pHoss1 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pHoss1 vector Sequence
LOCUS V000841 8859 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000841
VERSION V000841
KEYWORDS pHoss1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 8859)
AUTHORS Abdelhamed H, Lawrence ML, Karsi A
TITLE A novel suicide plasmid for efficient gene mutation in Listeria
monocytogenes.
JOURNAL Plasmid. 2015 May 31;81:1-8. doi: 10.1016/j.plasmid.2015.05.003.
PUBMED 26038185
REFERENCE 2 (bases 1 to 8859)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 8859)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Plasmid.";
date: "2015-05-31"; pages: "
10.1016/j.plasmid.2015.05.003"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..8859
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS complement(98..829)
/gene="ermC"
/label="rRNA adenine N-6-methyltransferase"
/note="rRNA adenine N-6-methyltransferase from
Staphylococcus aureus. Accession#: P02979"
CDS 1241..2449
/gene="pre"
/label="Plasmid recombination enzyme type 1"
/note="Plasmid recombination enzyme type 1 from
Staphylococcus aureus. Accession#: P03857"
CDS complement(4072..4695)
/label="TetR"
/note="tetracycline repressor TetR"
protein_bind 4717..4735
/label="tet operator"
/note="bacterial operator O1 for the tetR and tetA genes"
protein_bind 4802..4820
/label="tet operator"
/bound_moiety="tetracycline repressor TetR"
/note="bacterial operator O1 for the tetR and tetA genes"
CDS 6416..6604
/label="rop"
/note="Rop protein, which maintains plasmids at low copy
number"
primer_bind complement(6601..6623)
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
misc_feature 6709..6849
/label="bom"
/note="basis of mobility region from pBR322"
primer_bind complement(6864..6881)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(7035..7623)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(7797..8654)
/label="AmpR"
/note="beta-lactamase"
promoter complement(8655..8759)
/label="AmpR promoter"
primer_bind 8827..8845
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"