pU6-pegRNA-GG-acceptor vector (V007253)

Basic Vector Information

      • Vector Name:
      • pU6-pegRNA-GG-acceptor
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 3004 bp
      • Type:
      • Mammalian Expression
      • Copy Number:
      • High Copy
      • Promoter:
      • U6
      • Cloning Method:
      • Ligation Independent Cloning
      • 5' Primer:
      • GACTATCATATGCTTACCGT

pU6-pegRNA-GG-acceptor vector Vector Map

pU6-pegRNA-GG-acceptor3004 bp6001200180024003000U6 promotertonB terminatormRFP1RBStet operatortet operatororiAmpRAmpR promoter

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

pU6-pegRNA-GG-acceptor vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       pU6-pegRNA-GG-ac        3004 bp DNA     circular SYN 13-MAY-2021
DEFINITION  Prime editing in mammalian cells.
ACCESSION   .
VERSION     .
KEYWORDS    pU6-pegRNA-GG-acceptor.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 3004)
  AUTHORS   Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, 
            Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR
  TITLE     Search-and-replace genome editing without double-strand breaks or 
            donor DNA.
  JOURNAL   Nature. 2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi: 
            10.1038/s41586-019-1711-4.
  PUBMED    31634902
REFERENCE   2  (bases 1 to 3004)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 3004)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nature. 
            2019 Oct 21. pii: 10.1038/s41586-019-1711-4. doi: 
            10.1038/s41586-019-1711-4."
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..3004
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        1..241
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     terminator      complement(259..290)
                     /label=tonB terminator
                     /note="bidirectional E. coli tonB-P14 transcription
                     terminator"
     CDS             complement(310..984)
                     /label=mRFP1
                     /note="monomeric derivative of DsRed (Campbell et al.,
                     2002)"
     RBS             991..1002
                     /note="strong bacterial ribosome binding site (Elowitz and 
                     Leibler, 2000)"
     protein_bind    1020..1038
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    complement(1045..1063)
                     /label=tet operator
                     /note="bacterial operator O2 for the tetR and tetA genes"
     rep_origin      complement(1174..1762)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(1936..2793)
                     /label=AmpR
                     /note="beta-lactamase"
     promoter        complement(2794..2898)
                     /label=AmpR promoter

This page is informational only.