p11-LacY-wtx1 vector (V007313) Gene synthesis in p11-LacY-wtx1 backbone

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V007313 p11-LacY-wtx1 In stock, instant shipping

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
p11-LacY-wtx1
Antibiotic Resistance:
Ampicillin
Length:
6092 bp
Replication origin:
ori
Selection Marker:
Ampicillin
Promoter:
araBAD
Cloning Method:
Restriction Enzyme
5' Primer:
gagctc aggcct gactcactatagggagaccg
3' Primer:
ctagct aggccttaagcgacttcattcacct
Growth Strain(s):
DH10B

p11-LacY-wtx1 vector Map

p11-LacY-wtx16092 bp30060090012001500180021002400270030003300360039004200450048005100540057006000araCaraBAD promoterccdBpBAD ReverserrnB T1 terminatorrrnB T2 terminatorAmpR promoterAmpRf1 orioriL4440CAP binding sitelac promoterlac operatorM13 revM13 fwdLactose permease

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

p11-LacY-wtx1 vector Sequence

LOCUS       V007313                 6092 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V007313
VERSION     V007313
KEYWORDS    p11-LacY-wtx1
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 6092)
  AUTHORS   Chen Z, Zhao H
  TITLE     A highly sensitive selection method for directed evolution of homing
            endonucleases.
  JOURNAL   Nucleic Acids Res. 2005 Oct 6;33(18):e154.
   PUBMED   16214805
REFERENCE   2  (bases 1 to 6092)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6092)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nucleic
            Acids Res."; date: "2005-10-6"; volume: "33(18)"; pages: "e154"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6092
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             complement(98..973)
                     /label="araC"
                     /note="L-arabinose regulatory protein"
     promoter        1000..1284
                     /label="araBAD promoter"
                     /note="promoter of the L-arabinose operon of E. coli; the
                     araC regulatory gene is transcribed in the opposite
                     direction (Guzman et al., 1995)"
     CDS             1316..1618
                     /label="ccdB"
                     /note="CcdB, a bacterial toxin that poisons DNA gyrase"
     primer_bind     complement(1716..1733)
                     /label="pBAD Reverse"
                     /note="For vectors with E. coli araBAD promoter, reverse
                     primer"
     terminator      1886..1972
                     /label="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     terminator      2064..2091
                     /label="rrnB T2 terminator"
                     /note="transcription terminator T2 from the E. coli rrnB
                     gene"
     promoter        2110..2201
                     /label="AmpR promoter"
     CDS             2202..3059
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      3104..3559
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     rep_origin      3670..4258
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     4412..4429
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     protein_bind    4594..4615
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4630..4660
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4668..4684
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4692..4708
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(4724..4740)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     CDS             4834..6084
                     /gene="lacY"
                     /label="Lactose permease"
                     /note="Lactose permease from Escherichia coli (strain K12).
                     Accession#: P02920"