LeGO-EBFP2 vector (Cat. No.: V007360)

LeGO-EBFP27135 bp30060090012001500180021002400270030003300360039004200450048005100540057006000630066006900pRS-markerCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSKS primerloxPSFFV promoterEBFP2loxPWPREKS primer5' LTR (truncated)oriAmpRAmpR promoter
Basic Information
Name:
LeGO-EBFP2
Antibiotic Resistance:
Ampicillin
Length:
7135 bp
Type:
Mammalian Expression, Lentiviral, Cre/Lox
Replication origin:
ori
Copy Number:
High Copy
Promoter:
SFFV
Cloning Method:
Restriction Enzyme
5' Primer:
GAGCTCACAACCCCTCACTC
$ 198.2
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

LeGO-EBFP2 vector (Cat. No.: V007360) Sequence

LOCUS       V007360                 7135 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V007360
VERSION     V007360
KEYWORDS    LeGO-EBFP2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7135)
  AUTHORS   Mohme M, Maire CL, Riecken K, Zapf S, Aranyossy T, Westphal M,
            Lamszus K, Fehse B
  TITLE     Optical Barcoding for Single-Clone Tracking to Study Tumor
            Heterogeneity.
  JOURNAL   Mol Ther. 2017 Jan 18. pii: S1525-0016(16)45496-1. doi:
            10.1016/j.ymthe.2016.12.014.
   PUBMED   28109958
REFERENCE   2  (bases 1 to 7135)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7135)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Mol Ther.
            2017 Jan 18. pii: S1525-0016(16)45496-1. doi:
            10.1016/j.ymthe.2016.12.014."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7135
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     primer_bind     complement(47..66)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     enhancer        238..617
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        618..820
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             835..1015
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1062..1187
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1684..1917
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2102..2146
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2295..2336
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2444..2561
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     primer_bind     2620..2636
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    2678..2711
                     /label="loxP"
                     /bound_moiety="Cre recombinase"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (GCATACAT)."
     promoter        2778..3184
                     /label="SFFV promoter"
                     /note="spleen focus-forming virus long terminal repeat
                     (LTR) promoter"
     CDS             3196..3912
                     /label="EBFP2"
                     /note="enhanced blue variant of GFP (Ai et al., 2007)"
     protein_bind    complement(3935..3968)
                     /label="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     misc_feature    4024..4612
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(4615..4631)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             5141..5321
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(5383..5971)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6145..7002)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7003..7107)
                     /label="AmpR promoter"