CGBE1 (pRZ3885) vector (Cat. No.: V007416)
- Name:
- CGBE1 (pRZ3885)
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9909 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CMV
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- CGCAAATGGGCGGTAGGCGTG
- 3' Primer:
- TAGAAGGCACAGTCGAGG
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
CGBE1 (pRZ3885) vector (Cat. No.: V007416) Sequence
LOCUS V007416 9909 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V007416
VERSION V007416
KEYWORDS CGBE1 (pRZ3885)
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9909)
AUTHORS Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald
J, Joung JK
TITLE CRISPR C-to-G base editors for inducing targeted DNA transversions
in human cells.
JOURNAL Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi:
10.1038/s41587-020-0609-x.
PUBMED 32690971
REFERENCE 2 (bases 1 to 9909)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9909)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi:
10.1038/s41587-020-0609-x."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9909
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind 220..239
/label="pBR322ori-F"
/note="pBR322 origin, forward primer"
primer_bind 473..490
/label="L4440"
/note="L4440 vector, forward primer"
protein_bind 607..628
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 643..673
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 681..697
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 705..721
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
polyA_signal complement(792..1016)
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
CDS complement(1045..1062)
/label="6xHis"
/note="6xHis affinity tag"
CDS complement(1071..1787)
/label="EGFP"
/note="enhanced GFP"
CDS complement(1788..1844)
/codon_start=1
/product="2A peptide from porcine teschovirus-1
polyprotein"
/label="P2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="ATNFSLLKQAGDVEENPGP"
CDS complement(1863..1883)
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS complement(1926..6026)
/label="Cas9(D10A)"
/note="nickase mutant of the Cas9 endonuclease from the
Streptococcus pyogenes Type II CRISPR/Cas system"
CDS complement(6123..6806)
/label="APOBEC-1"
/note="cytidine deaminase (C to U editing enzyme) from rat"
CDS complement(6837..7523)
/gene="ung"
/label="Uracil-DNA glycosylase"
/note="Uracil-DNA glycosylase from Escherichia coli (strain
K12). Accession#: P12295"
CDS complement(7521..7541)
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
promoter complement(7591..7609)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
promoter complement(7651..7854)
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
enhancer complement(7855..8234)
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
primer_bind 8406..8425
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
promoter 8504..8608
/label="AmpR promoter"
CDS 8609..9466
/label="AmpR"
/note="beta-lactamase"
rep_origin 9640..9909
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"