CRISPRoff-v2.1 vector (V007493#)

Basic Vector Information

Basic Vector Information
Vector Name CRISPRoff-v2.1 Antibiotic Resistance Ampicillin
Length 11885 bp Type Mammalian Expression
Copy Number High Copy Promoter CAG
Cloning Method Gibson Cloning 5' Primer ggcaaagaattctgcagtcg
3' Primer ccaccaccttctgataggc

CRISPRoff-v2.1 vector Vector Map

CRISPRoff-v2.111885 bp50010001500200025003000350040004500500055006000650070007500800085009000950010000105001100011500CMV enhancerchicken beta-actin promoterchimeric intronpCAG-FdCas9HASV40 NLSSV40 NLSTagBFPKRABBglob-pA-Rbeta-globin poly(A) signalM13 revlac operatorlac promoterCAP binding siteSV40 promoterSV40 poly(A) signalL4440oriAmpRAmpR promoter

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

CRISPRoff-v2.1 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported               11885 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  Expresses CRISPRoff-v2.1 
            (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-BFP-KRAB) downstream of the CAG
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 11885)
  AUTHORS   Nunez JK, Chen J, Pommier GC, Cogan JZ, Replogle JM, Adriaens C, 
            Ramadoss GN, Shi Q, Hung KL, Samelson AJ, Pogson AN, Kim JYS, Chung 
            A, Leonetti MD, Chang HY, Kampmann M, Bernstein BE, Hovestadt V, 
            Gilbert LA, Weissman JS
  TITLE     Genome-wide programmable transcriptional memory by CRISPR-based 
            epigenome editing.
  JOURNAL   Cell. 2021 Apr 7. pii: S0092-8674(21)00353-6. doi: 
  PUBMED    33838111
REFERENCE   2  (bases 1 to 11885)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2021 
            Apr 7. pii: S0092-8674(21)00353-6. doi: 10.1016/j.cell.2021.03.025."
FEATURES             Location/Qualifiers
     source          1..11885
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        5..384
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        386..662
                     /label=chicken beta-actin promoter
     intron          663..1679
                     /label=chimeric intron
                     /note="chimera between introns from chicken beta-actin and 
                     rabbit beta-globin"
     primer_bind     1603..1625
                     /note="Chimeric intron in CAG promoter, forward primer"
     primer_bind     1687..1706
                     /note="Rabbit beta-globin intron, for pCAG plasmids, 
                     forward primer"
     CDS             3650..7753
                     /product="catalytically dead mutant of the Cas9 
                     endonuclease from the Streptococcus pyogenes Type II 
                     CRISPR/Cas system"
                     /note="RNA-guided DNA-binding protein that lacks 
                     endonuclease activity due to the D10A mutation in the RuvC 
                     catalytic domain and the H840A mutation in the HNH 
                     catalytic domain"
     CDS             7757..7783
                     /product="HA (human influenza hemagglutinin) epitope tag"
     CDS             7802..7822
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             7829..7849
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             7889..8584
                     /product="monomeric blue fluorescent protein"
                     /note="mammalian codon-optimized"
     CDS             8630..8815
                     /product="Kruppel-associated box (KRAB) transcriptional 
                     repression domain from the human zinc finger protein ZNF10 
                     (Margolin et al., 1994)"
     primer_bind     complement(8907..8926)
                     /note="Rabbit beta-globin polyA region, reverse primer"
     polyA_signal    8972..9027
                     /label=beta-globin poly(A) signal
                     /note="rabbit beta-globin polyadenylation signal (Gil and 
                     Proudfoot, 1987)"
     primer_bind     complement(9026..9045)
                     /note="Rabbit beta-globin polyA, reverse primer. Also 
                     called rb-glob-pA-term-R"
     primer_bind     complement(9388..9404)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(9388..9404)
                     /label=M13 Reverse
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(9401..9423)
                     /label=M13/pUC Reverse
                     /note="In lacZ gene"
     protein_bind    9412..9428
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(9436..9466)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    9481..9502
                     /label=CAP binding site
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     promoter        9561..9756
                     /label=SV40 promoter
                     /note="SV40 early promoter"
     rep_origin      9607..9742
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     primer_bind     9669..9688
                     /note="SV40 promoter/origin, forward primer"
     polyA_signal    9762..9896
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(9799..9818)
                     /note="SV40 polyA, reverse primer"
     primer_bind     9853..9872
                     /note="SV40 polyA terminator, reverse primer"
     primer_bind     complement(9964..9981)
                     /note="L4440 vector, forward primer"
     rep_origin      complement(10135..10723)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     complement(10215..10234)
                     /note="pBR322 origin, forward primer"
     CDS             complement(10894..11754)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     11517..11536
                     /note="Ampicillin resistance gene, reverse primer"
     promoter        complement(11755..11859)
                     /label=AmpR promoter

This page is informational only.