AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato vector (V006648)

Basic Vector Information

      • Vector Name:
      • AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 7255 bp
      • Type:
      • Mammalian Expression, AAV
      • Copy Number:
      • High Copy
      • Promoter:
      • CaMKIIa 1.3 kb
      • Cloning Method:
      • Restriction Enzyme
      • 5' Primer:
      • ttctccgtttgcactcaggagc
      • 3' Primer:

AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato vector Vector Map

AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato7255 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300660069007200AAV2 ITRCaMKII promoterKozak sequenceP2ASV40 NLSdTomatoWPREbGH poly(A) signalAAV2 ITRf1 oripRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRori

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                7255 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  Forebrain principle neuron specific expression of GCaMP6f Ca sensor 
            and physically separate nuclear localized dTomato fluorophore .
KEYWORDS    AAV-CaMKIIa-GCaMP6f-P2A-nls-dTomato
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7255)
  TITLE     Ting GCaMP6 plasmids
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 7255)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: 
FEATURES             Location/Qualifiers
     source          1..7255
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     repeat_region   1..141
                     /label=AAV2 ITR
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     repeat_region   12..141
                     /label=AAV2 ITR
     promoter        164..1452
                     /label=CaMKII promoter
                     /note="promoter for the mouse calcium/calmodulin-dependent 
                     kinase II alpha subunit"
     regulatory      1465..1474
                     /label=Kozak sequence
                     /note="vertebrate consensus sequence for strong initiation 
                     of translation (Kozak, 1987)"
     CDS             1471..2820
                     /product="improved fluorescent protein-based calcium sensor
                     (Chen et al., 2013)"
     regulatory      1567..1576
                     /label=Kozak sequence
                     /note="vertebrate consensus sequence for strong initiation 
                     of translation (Kozak, 1987)"
     primer_bind     1857..1878
                     /note="EGFP, forward primer"
     primer_bind     complement(1984..2005)
                     /note="EGFP, reverse primer"
     primer_bind     complement(2245..2264)
                     /note="For distinguishing EGFP variants, reverse primer"
     CDS             2836..2892
                     /product="2A peptide from porcine teschovirus-1 
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
     CDS             2905..2925
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             2926..3624
                     /product="dimeric variant of DsRed fluorescent protein 
                     (Shaner et al., 2004)"
                     /note="mammalian codon-optimized"
     primer_bind     complement(3056..3074)
                     /note="mCherry, reverse primer"
     primer_bind     3324..3343
                     /note="mCherry, forward primer"
     primer_bind     3518..3541
                     /note="DsRed1, forward primer"
     misc_feature    3674..4262
                     /note="woodchuck hepatitis virus posttranscriptional 
                     regulatory element"
     primer_bind     complement(3727..3747)
                     /note="WPRE, reverse primer"
     CDS             complement(4145..4156)
                     /product="Factor Xa recognition and cleavage site"
                     /label=Factor Xa site
     polyA_signal    4295..4406
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     repeat_region   4518..4658
                     /label=AAV2 ITR
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     repeat_region   4518..4647
                     /label=AAV2 ITR
     rep_origin      4733..5188
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(4820..4839)
                     /note="F1 origin, reverse primer"
     primer_bind     5030..5051
                     /note="F1 origin, forward primer"
     primer_bind     complement(5205..5224)
                     /note="pRS vectors, use to sequence yeast selectable 
     primer_bind     5324..5346
                     /label=pGEX 3'
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(5384..5402)
                     /note="pBR322 vectors, upsteam of EcoRI site, forward 
     promoter        5470..5574
                     /label=AmpR promoter
     CDS             5575..6435
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     complement(5793..5812)
                     /note="Ampicillin resistance gene, reverse primer"
     rep_origin      6606..7194
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     7095..7114
                     /note="pBR322 origin, forward primer"

This page is informational only.