FUW-tetO-hOKMS vector (V006649)

Basic Vector Information

      • Vector Name:
      • FUW-tetO-hOKMS
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 13356 bp
      • Type:
      • Mammalian Expression, Lentiviral
      • Copy Number:
      • High Copy
      • Promoter:
      • tetO
      • Cloning Method:
      • Restriction Enzyme
      • 5' Primer:
      • agagctcgtttagtgaaccg
      • 3' Primer:
      • gttgcgtcagcaaacacagt

FUW-tetO-hOKMS vector Vector Map

FUW-tetO-hOKMS13356 bp600120018002400300036004200480054006000660072007800840090009600102001080011400120001260013200CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptidecPPT/CTStet operatortet operatortet operatortet operatortet operatortet operatorminimal CMV promoterT2AP2Ac-MycE2AWPREKS primer5' LTR (truncated)BGH-revf1 oripBABE 3'EM7 promoterBleoRSV40 poly(A) signalM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-marker

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

FUW-tetO-hOKMS vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported               13356 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  Inducible expression of polycistronic 2A spaced OCT4-KLF4-MYC-SOX2.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 13356)
  AUTHORS   Cacchiarelli D, Trapnell C, Ziller MJ, Soumillon M, Cesana M, Karnik
            R, Donaghey J, Smith ZD, Ratanasirintrawoot S, Zhang X, Ho Sui SJ, 
            Wu Z, Akopian V, Gifford CA, Doench J, Rinn JL, Daley GQ, Meissner 
            A, Lander ES, Mikkelsen TS
  TITLE     Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of
            Induced Pluripotency.
  JOURNAL   Cell. 2015 Jul 16;162(2):412-24. doi: 10.1016/j.cell.2015.06.016.
  PUBMED    26186193
REFERENCE   2  (bases 1 to 13356)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1016/j.cell.2015.06"; journalName: "Cell"; date: "2015-07-16- 
            16"; volume: "162"; issue: "2"; pages: "412-24"
FEATURES             Location/Qualifiers
     source          1..13356
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     enhancer        7..386
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        388..586
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early 
     primer_bind     541..561
                     /note="Human CMV immediate early promoter, forward primer"
     LTR             604..784
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    831..956
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus 
                     type 1"
     misc_feature    1449..1682
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
     CDS             1867..1911
                     /product="antigenic peptide corresponding to amino acids 
                     655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik 
                     et al., 2013)"
                     /label=gp41 peptide
                     /note="recognized by the 2H10 single-chain llama nanobody"
     misc_feature    2209..2326
                     /note="central polypurine tract and central termination 
                     sequence of HIV-1"
     protein_bind    2383..2401
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2425..2443
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2467..2485
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2509..2527
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2551..2569
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2593..2611
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     promoter        2644..2682
                     /label=minimal CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early 
     primer_bind     2679..2703
                     /note="Human CMV promoter, forward primer"
     CDS             3915..3968
                     /product="2A peptide from Thosea asigna virus capsid 
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
     CDS             5388..5444
                     /product="2A peptide from porcine teschovirus-1 
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
     CDS             5445..6761
                     /product="human c-Myc proto-oncogene"
     CDS             6771..6830
                     /product="2A peptide from equine rhinitis A virus 
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
     misc_feature    7817..8405
                     /note="woodchuck hepatitis virus posttranscriptional 
                     regulatory element"
     primer_bind     complement(7870..7890)
                     /note="WPRE, reverse primer"
     CDS             complement(8288..8299)
                     /product="Factor Xa recognition and cleavage site"
                     /label=Factor Xa site
     primer_bind     complement(8408..8424)
                     /label=KS primer
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(8409..8425)
                     /note="For pBluescript vector"
     LTR             8930..9110
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     primer_bind     complement(9136..9153)
                     /note="Bovine growth hormone terminator, reverse primer. 
                     Also called BGH reverse"
     polyA_signal    9142..9366
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      9412..9840
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(9499..9518)
                     /note="F1 origin, reverse primer"
     primer_bind     9709..9730
                     /note="F1 origin, forward primer"
     primer_bind     complement(9849..9869)
                     /label=pBABE 3'
                     /note="SV40 enhancer, reverse primer for pBABE vectors"
     promoter        9854..10183
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     rep_origin      10034..10169
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     primer_bind     10096..10115
                     /note="SV40 promoter/origin, forward primer"
     promoter        10231..10278
                     /label=EM7 promoter
                     /note="synthetic bacterial promoter "
     CDS             10297..10671
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     polyA_signal    10801..10922
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(10838..10857)
                     /note="SV40 polyA, reverse primer"
     primer_bind     10892..10911
                     /note="SV40 polyA terminator, reverse primer"
     primer_bind     complement(10971..10987)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(10971..10987)
                     /label=M13 Reverse
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(10984..11006)
                     /label=M13/pUC Reverse
                     /note="In lacZ gene"
     protein_bind    10995..11011
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(11019..11049)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    11064..11085
                     /label=CAP binding site
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     primer_bind     complement(11202..11219)
                     /note="L4440 vector, forward primer"
     rep_origin      complement(11373..11961)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     complement(11453..11472)
                     /note="pBR322 origin, forward primer"
     CDS             complement(12132..12992)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     12755..12774
                     /note="Ampicillin resistance gene, reverse primer"
     promoter        complement(12993..13097)
                     /label=AmpR promoter
     primer_bind     complement(13172..13191)
                     /note="pRS vectors, use to sequence yeast selectable 

This page is informational only.