FUW-tetO-hOKMS vector (Cat. No.: V006649)

FUW-tetO-hOKMS13398 bp600120018002400300036004200480054006000660072007800840090009600102001080011400120001260013200CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTStet operatortet operatortet operatortet operatortet operatortet operatortet operatorminimal CMV promoterhOct4T2AhKLF4P2Ac-MycE2AhSOX2WPREpBluescriptKS5' LTR (truncated)bGH poly(A) signalf1 oripBABE 3'SV40 oriEM7 promoterBleoRSV40 poly(A) signalM13/pUC Reverselac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-marker
Basic Information

Note: Inducible expression of the polycistronic OCT4-KLF4-MYC-SOX2 cassette linked by 2A peptides

Name:
FUW-tetO-hOKMS
Antibiotic Resistance:
Ampicillin
Length:
13398 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Copy Number:
High Copy
Promoter:
EM7
Cloning Method:
Restriction Enzyme
5' Primer:
agagctcgtttagtgaaccg
3' Primer:
gttgcgtcagcaaacacagt
Growth Strain(s):
Stbl3
Growth Temperature:
37℃
$ 248.4
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Cacchiarelli D, Trapnell C, Ziller MJ, Soumillon M, Cesana M, Karnik R, Donaghey J, Smith ZD, Ratanasirintrawoot S, Zhang X, Ho Sui SJ, Wu Z, Akopian V, Gifford CA, Doench J, Rinn JL, Daley GQ, Meissner A, Lander ES, Mikkelsen TS. Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of Induced Pluripotency. Cell. 2015 Jul 16;162(2):412-424. doi: 10.1016/j.cell.2015.06.016. PMID: 26186193; PMCID: PMC4511597.

FUW-tetO-hOKMS vector (Cat. No.: V006649) Sequence

LOCUS       Exported               13398 bp DNA     circular SYN 20-DEC-2025
DEFINITION  Exported.
ACCESSION   V006649
VERSION     .
KEYWORDS    FUW-tetO-hOKMS
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 13398)
  AUTHORS   Cacchiarelli D, Trapnell C, Ziller MJ, Soumillon M, Cesana M, Karnik
            R, Donaghey J, Smith ZD, Ratanasirintrawoot S, Zhang X, Ho Sui SJ, 
            Wu Z, Akopian V, Gifford CA, Doench J, Rinn JL, Daley GQ, Meissner 
            A, Lander ES, Mikkelsen TS
  TITLE     Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of
            Induced Pluripotency.
  JOURNAL   Cell. 2015 Jul 16;162(2):412-24. doi: 10.1016/j.cell.2015.06.016.
  PUBMED    26186193
REFERENCE   2  (bases 1 to 13398)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 13398)
  TITLE     Direct Submission
REFERENCE   4  (bases 1 to 13398)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1016/j.cell.2015.06"; journalName: "Cell"; date: "2015-07-16-
            16"; volume: "162"; issue: "2"
COMMENT     SGRef: number: 2; type: "Journal Article"
COMMENT     SGRef: number: 3; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..13398
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        7..386
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        387..589
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             604..784
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    831..956
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1449..1682
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             1867..1911
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             2060..2101
                     /label=Protein Tat
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     misc_feature    2209..2326
                     /label=cPPT/CTS
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     protein_bind    2383..2401
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2425..2443
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2467..2485
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2509..2527
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2551..2569
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2593..2611
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     protein_bind    2635..2653
                     /gene="tetO"
                     /label=tet operator
                     /bound_moiety="tetracycline repressor TetR"
                     /note="bacterial operator O2 for the tetR and tetA genes"
     promoter        2686..2724
                     /label=minimal CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     primer_bind     2721..2745
                     /label=LNCX
                     /note="Human CMV promoter, forward primer"
     CDS             2868..3947
                     /label=hOct4
                     /note="Homo sapiens Oct-4 gene. Encodes a transcription
                     factor containing a POU homeodomain that plays a key role 
                     in embryonic development and stem cell pluripotency. 
                     Aberrant expression in adult tissues is associated with 
                     tumorigenesis."
     CDS             3957..4010
                     /codon_start=1
                     /product="2A peptide from Thosea asigna virus capsid
                     protein"
                     /label=T2A
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
                     polypeptides."
                     /translation="EGRGSLLTCGDVEENPGP"
     CDS             4011..5420
                     /label=hKLF4
                     /note="Homo sapiens Kruppel-like factor 4 (Klf4) gene.
                     Belongs to the relatively large family of SP1-like 
                     transcription factors and is involved in the regulation of 
                     proliferation, differentiation, apoptosis and somatic cell 
                     reprogramming."
     CDS             5430..5486
                     /codon_start=1
                     /product="2A peptide from porcine teschovirus-1
                     polyprotein"
                     /label=P2A
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
                     polypeptides."
                     /translation="ATNFSLLKQAGDVEENPGP"
     CDS             5487..6803
                     /label=c-Myc
                     /note="human c-Myc proto-oncogene"
     CDS             6813..6872
                     /codon_start=1
                     /product="2A peptide from equine rhinitis A virus
                     polyprotein"
                     /label=E2A
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
                     polypeptides."
                     /translation="QCTNYALLKLAGDVESNPGP"
     CDS             6873..7823
                     /label=hSOX2
                     /note="Homo sapiens transcription factor SOX-2 gene.
                     Belongs to the SRY-related HMG-box (SOX) family of 
                     transcription factors, which is involved in the regulation 
                     of embryonic development and in the determination of cell 
                     fate"
     misc_feature    7859..8447
                     /label=WPRE
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(8450..8466)
                     /label=KS primer
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     primer_bind     complement(8451..8467)
                     /label=pBluescriptKS
                     /note="For pBluescript vector"
     LTR             8972..9152
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     polyA_signal    9184..9408
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      9454..9882
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(9891..9911)
                     /label=pBABE 3'
                     /note="SV40 enhancer, reverse primer for pBABE vectors"
     rep_origin      10076..10211
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     promoter        10273..10320
                     /label=EM7 promoter
                     /note="synthetic bacterial promoter"
     CDS             10339..10710
                     /label=BleoR
                     /note="antibiotic-binding protein"
     polyA_signal    10843..10976
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(11013..11029)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     primer_bind     complement(11013..11029)
                     /label=M13 Reverse
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(11026..11048)
                     /label=M13/pUC Reverse
                     /note="In lacZ gene"
     protein_bind    11037..11053
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(11061..11091)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(11106..11127)
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(11244..11261)
                     /label=L4440
                     /note="L4440 vector, forward primer"
     rep_origin      complement(11415..12003)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(12177..13034)
                     /label=AmpR
                     /note="beta-lactamase"
     promoter        complement(13035..13139)
                     /label=AmpR promoter
     primer_bind     complement(13214..13233)
                     /label=pRS-marker
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"