Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector (V006687)

Basic Vector Information

      • Vector Name:
      • Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 15284 bp
      • Type:
      • Mammalian Expression, Lentiviral, CRISPR
      • Replication origin:
      • ori
      • Copy Number:
      • High Copy
      • Promoter:
      • U6
      • Cloning Method:
      • Gibson Cloning
      • 5' Primer:
      • TAAGAAGTACGGCGGCTTCG

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector Vector Map

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP15284 bp700140021002800350042004900560063007000770084009100980010500112001190012600133001400014700AmpR promoterCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509cPPT/CTSU6 promotergRNA scaffoldEF-1-alpha core promoterdCas9EGFPWPRE3' LTR (Delta-U3)bGH poly(A) signalf1 oriSV40 promoterEM7 promoterBleoRSV40 poly(A) signallac promoterCAP binding siteoriAmpR

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Lenti-(BB)-EF1a-       15284 bp DNA     circular SYN 13-MAY-2021
DEFINITION  Catalytically inactive Cas9 from S. pyogenes with P2A-EGFP under the
            EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI 
            sites for insertion of spacer sequences..
ACCESSION   .
VERSION     .
KEYWORDS    Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 15284)
  TITLE     Ferrer Lab Plasmids
REFERENCE   2  (bases 1 to 15284)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 15284)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..15284
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        complement(176..280)
                     /label=AmpR promoter
     enhancer        546..925
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        926..1128
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             1143..1323
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1370..1495
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1988..2221
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             2406..2450
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             2599..2640
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     misc_feature    2748..2865
                     /label=cPPT/CTS
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2916..3156
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     misc_RNA        5046..5121
                     /label=gRNA scaffold
                     /note="guide RNA scaffold for the Streptococcus pyogenes 
                     CRISPR/Cas9 system"
     promoter        5183..5394
                     /label=EF-1-alpha core promoter
                     /note="core promoter for human elongation factor 
                     EF-1-alpha"
     CDS             5650..9753
                     /label=dCas9
                     /note="catalytically dead mutant of the Cas9 endonuclease
                     from the Streptococcus pyogenes Type II CRISPR/Cas system"
     CDS             9946..10659
                     /label=EGFP
                     /note="enhanced GFP"
     misc_feature    10684..11272
                     /label=WPRE
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             11344..11577
                     /label=3' LTR (Delta-U3)
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    11609..11833
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      11879..12307
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        12321..12650
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     promoter        12698..12745
                     /label=EM7 promoter
                     /note="synthetic bacterial promoter"
     CDS             12764..13135
                     /label=BleoR
                     /note="antibiotic-binding protein"
     polyA_signal    13268..13401
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     promoter        complement(13486..13516)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(13531..13552)
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(13840..14428)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(join(14602..15284,1..175))
                     /label=AmpR
                     /note="beta-lactamase"

This page is informational only.