Basic Vector Information
- Vector Name:
- GFP_CD47_LU
- Antibiotic Resistance:
- Ampicillin
- Length:
- 11265 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Selection Marker:
- Neomycin (select with G418)
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GGTGAACTTCAAGATCCGCC
- 3' Primer:
- BGH Rev
GFP_CD47_LU vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
GFP_CD47_LU vector Sequence
LOCUS GFP_CD47_LU. 11265 bp DNA circular SYN 13-MAY-2021 DEFINITION GFP tagged CD47 with its own long 3'UTR. ACCESSION . VERSION . KEYWORDS GFP_CD47_LU. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 11265) AUTHORS Berkovits BD, Mayr C TITLE Alternative 3' UTRs act as scaffolds to regulate membrane protein localization. JOURNAL Nature. 2015 Apr 20. doi: 10.1038/nature14321. PUBMED 25896326 REFERENCE 2 (bases 1 to 11265) TITLE Direct Submission REFERENCE 3 (bases 1 to 11265) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nature. 2015 Apr 20. doi: 10.1038/nature14321." COMMENT SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..11265 /mol_type="other DNA" /organism="synthetic DNA construct" primer_bind complement(44..63) /label=pRS-marker /note="pRS vectors, use to sequence yeast selectable marker" enhancer 235..614 /label=CMV enhancer /note="human cytomegalovirus immediate early enhancer" promoter 615..818 /label=CMV promoter /note="human cytomegalovirus (CMV) immediate early promoter" promoter 863..881 /label=T7 promoter /note="promoter for bacteriophage T7 RNA polymerase" CDS 995..1711 /label=EGFP /note="enhanced GFP" RBS 3406..3417 /note="strong bacterial ribosome binding site (Elowitz and Leibler, 2000)" polyA_signal 6865..7089 /label=bGH poly(A) signal /note="bovine growth hormone polyadenylation signal" rep_origin 7135..7563 /label=f1 ori /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 7577..7906 /label=SV40 promoter /note="SV40 enhancer and early promoter" CDS 7973..8764 /label=NeoR/KanR /note="aminoglycoside phosphotransferase" polyA_signal 8941..9074 /label=SV40 poly(A) signal /note="SV40 polyadenylation signal" primer_bind complement(9111..9127) /label=M13 rev /note="common sequencing primer, one of multiple similar variants" primer_bind complement(9111..9127) /label=M13 Reverse /note="In lacZ gene. Also called M13-rev" primer_bind complement(9124..9146) /label=M13/pUC Reverse /note="In lacZ gene" protein_bind 9135..9151 /label=lac operator /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(9159..9189) /label=lac promoter /note="promoter for the E. coli lac operon" protein_bind complement(9204..9225) /label=CAP binding site /note="CAP binding activates transcription in the presence of cAMP." primer_bind complement(9342..9359) /label=L4440 /note="L4440 vector, forward primer" rep_origin complement(9513..10098) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(10272..11129) /label=AmpR /note="beta-lactamase" promoter complement(11130..11234) /label=AmpR promoter
This page is informational only.