AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR vector (V006717)

Basic Vector Information

      • Vector Name:
      • AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 6362 bp
      • Type:
      • Mammalian Expression, Mouse Targeting, AAV, Cre/Lo
      • Copy Number:
      • High Copy
      • Promoter:
      • CBh
      • Cloning Method:
      • Restriction Enzyme
      • 5' Primer:
      • ctgagcaagaggtaagggtttaagg
      • 3' Primer:
      • cacatagcgtaaaaggagcaacatag

AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR vector Vector Map

AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR6362 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300AAV2 ITR (alternate)U6 promotergRNA scaffoldCMV enhancerchicken beta-actin promoterhybrid intronSV40 NLSHAWPREhGH poly(A) signalAAV2 ITRf1 oripRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRori

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                6362 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  Expresses Cre recombinase from the Cbh promoter and one U6-driven 
            sgRNA. AAV backbone with SapI spacer for sgRNA cloning..
KEYWORDS    AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6362)
  AUTHORS   Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, 
            Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, 
            Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A,
            Feng G, Sharp PA, Zhang F
  TITLE     CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling.
  JOURNAL   Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 
  PUBMED    25263330
REFERENCE   2  (bases 1 to 6362)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2014 
            Sep 24. pii: S0092-8674(14)01163-5. doi: 
FEATURES             Location/Qualifiers
     source          1..6362
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     repeat_region   1..130
                     /label=AAV2 ITR (alternate)
                     /note="Functional equivalent of wild-type AAV2 ITR"
     promoter        145..385
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     primer_bind     145..165
                     /note="Human U6 promoter, forward primer"
     primer_bind     316..335
                     /label=LKO.1 5'
                     /note="Human U6 promoter, forward primer"
     misc_RNA        412..487
                     /label=gRNA scaffold
                     /note="guide RNA scaffold for the Streptococcus pyogenes 
                     CRISPR/Cas9 system"
     enhancer        577..862
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer; 
                     contains an 18-bp deletion relative to the standard CMV 
     promoter        864..1139
                     /label=chicken beta-actin promoter
     intron          1140..1367
                     /label=hybrid intron
                     /note="hybrid between chicken beta-actin (CBA) and minute 
                     virus of mice (MMV) introns (Gray et al., 2011)"
     CDS             1388..1408
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             2435..2461
                     /product="HA (human influenza hemagglutinin) epitope tag"
     misc_feature    2489..3077
                     /note="woodchuck hepatitis virus posttranscriptional 
                     regulatory element"
     primer_bind     complement(2542..2562)
                     /note="WPRE, reverse primer"
     CDS             complement(2960..2971)
                     /product="Factor Xa recognition and cleavage site"
                     /label=Factor Xa site
     polyA_signal    3109..3585
                     /label=hGH poly(A) signal
                     /note="human growth hormone polyadenylation signal"
     primer_bind     complement(3308..3327)
                     /note="Human growth hormone terminator, reverse primer"
     repeat_region   3625..3765
                     /label=AAV2 ITR
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     repeat_region   3625..3754
                     /label=AAV2 ITR
     rep_origin      3840..4295
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(3927..3946)
                     /note="F1 origin, reverse primer"
     primer_bind     4137..4158
                     /note="F1 origin, forward primer"
     primer_bind     complement(4312..4331)
                     /note="pRS vectors, use to sequence yeast selectable 
     primer_bind     4431..4453
                     /label=pGEX 3'
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(4491..4509)
                     /note="pBR322 vectors, upsteam of EcoRI site, forward 
     promoter        4577..4681
                     /label=AmpR promoter
     CDS             4682..5542
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     complement(4900..4919)
                     /note="Ampicillin resistance gene, reverse primer"
     rep_origin      5713..6301
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     6202..6221
                     /note="pBR322 origin, forward primer"

This page is informational only.