pRMC2 vector (Cat. No.: V006740)
- Name:
- pRMC2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 6555 bp
- Type:
- Bacterial Expression ; tet inducible E. coli/Staph
- Replication origin:
- ori
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- pRMC2 SEQF: ATTCAGGCTGCGCAAC
- 3' Primer:
- pRMC2 SEQR: TTGTTGACATTATATCATTG
- Growth Strain(s):
- DH10B
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pRMC2 vector (Cat. No.: V006740) Sequence
LOCUS V006740 6555 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V006740
VERSION V006740
KEYWORDS pRMC2
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 6555)
AUTHORS Corrigan RM, Foster TJ
TITLE An improved tetracycline-inducible expression vector for
Staphylococcus aureus.
JOURNAL Plasmid. 2009 Mar;61(2):126-9. doi: 10.1016/j.plasmid.2008.10.001.
Epub 2008 Nov 25.
PUBMED 18996145
REFERENCE 2 (bases 1 to 6555)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 6555)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1016/j.plasmid.2008.10.001"; journalName: "Plasmid"; date:
"2009-03"; volume: "61"; issue: "2"; pages: "126-9"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..6555
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind complement(18..40)
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind 140..159
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 368..384
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind 495..511
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(562..580)
/label="tet operator"
/note="bacterial operator O1 for the tetR and tetA genes"
CDS 687..1310
/label="TetR"
/note="tetracycline repressor TetR"
CDS complement(1625..1639)
/label="enterokinase site"
/note="enterokinase recognition and cleavage site"
CDS 3130..3777
/gene="cat"
/label="Chloramphenicol acetyltransferase"
/note="Chloramphenicol acetyltransferase from
Staphylococcus aureus. Accession#: P00485"
primer_bind complement(4323..4339)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(4347..4363)
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(4371..4401)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(4416..4437)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(4554..4571)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(4725..5313)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(5487..6344)
/label="AmpR"
/note="beta-lactamase"
promoter complement(6345..6449)
/label="AmpR promoter"
primer_bind 6517..6535
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"