pRMC2 vector (Cat. No.: V006740)

pRMC26555 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300pGEX 3'pRS-markerM13 fwdM13 fwdtet operatorTetRenterokinase sitecatM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterpBRforEco
Basic Information
Name:
pRMC2
Antibiotic Resistance:
Ampicillin
Length:
6555 bp
Type:
Bacterial Expression ; tet inducible E. coli/Staph
Replication origin:
ori
Cloning Method:
Restriction Enzyme
5' Primer:
pRMC2 SEQF: ATTCAGGCTGCGCAAC
3' Primer:
pRMC2 SEQR: TTGTTGACATTATATCATTG
Growth Strain(s):
DH10B
Growth Temperature:
37℃
$ 198.2
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pRMC2 vector (Cat. No.: V006740) Sequence

LOCUS       V006740                 6555 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V006740
VERSION     V006740
KEYWORDS    pRMC2
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 6555)
  AUTHORS   Corrigan RM, Foster TJ
  TITLE     An improved tetracycline-inducible expression vector for
            Staphylococcus aureus.
  JOURNAL   Plasmid. 2009 Mar;61(2):126-9. doi: 10.1016/j.plasmid.2008.10.001.
            Epub 2008 Nov 25.
   PUBMED   18996145
REFERENCE   2  (bases 1 to 6555)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6555)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1016/j.plasmid.2008.10.001"; journalName: "Plasmid"; date:
            "2009-03"; volume: "61"; issue: "2"; pages: "126-9"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6555
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     primer_bind     complement(18..40)
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     primer_bind     140..159
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     primer_bind     368..384
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     495..511
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    complement(562..580)
                     /label="tet operator"
                     /note="bacterial operator O1 for the tetR and tetA genes"
     CDS             687..1310
                     /label="TetR"
                     /note="tetracycline repressor TetR"
     CDS             complement(1625..1639)
                     /label="enterokinase site"
                     /note="enterokinase recognition and cleavage site"
     CDS             3130..3777
                     /gene="cat"
                     /label="Chloramphenicol acetyltransferase"
                     /note="Chloramphenicol acetyltransferase from
                     Staphylococcus aureus. Accession#: P00485"
     primer_bind     complement(4323..4339)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    complement(4347..4363)
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4371..4401)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(4416..4437)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(4554..4571)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(4725..5313)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(5487..6344)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(6345..6449)
                     /label="AmpR promoter"
     primer_bind     6517..6535
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"