Plenti CMV Puro DEST vector (Cat. No.: V006757)

Plenti CMV Puro DEST9628 bp4008001200160020002400280032003600400044004800520056006000640068007200760080008400880092009600AmpR promoterAmpRoriCAP binding sitelac promoterlac operatorM13 revT3 promoterRSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSCMV enhancerCMV promoterattR1lac UV5 promoterCmRccdBattR2WPREPGK promoterPuroR3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterM13 fwdf1 ori
Basic Information

Note: pLenti CMV Puro DEST is a lentiviral vector designed for high-efficiency gene delivery and stable expression in mammalian cells. It features a CMV promoter for strong constitutive expression, a puromycin resistance gene for selection in eukaryotic cells, and utilizes Gateway recombination technology for convenient cloning. The vector backbone includes an ampicillin resistance gene for propagation in E. coliand is approximately 9.6 kb in size. Please note that the cloning host is DB3.1.

Name:
Plenti CMV Puro DEST
Antibiotic Resistance:
Ampicillin
Length:
9628 bp
Type:
Lentiviral vectors
Replication origin:
ori
Source/Author:
Eric Campeau, Paul Kaufman
Selection Marker:
Puromycin
Copy Number:
High copy number
Promoter:
mPGK
5' Primer:
CMV-F: CGCAAATGGGCGGTAGGCGTG
Growth Strain(s):
Top10
Growth Temperature:
37℃
$ 198.7
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD. A versatile viral system for expression and depletion of proteins in mammalian cells. PLoS One. 2009 Aug 6;4(8):e6529. doi: 10.1371/journal.pone.0006529. PMID: 19657394; PMCID: PMC2717805.

Plenti CMV Puro DEST vector (Cat. No.: V006757) Sequence

LOCUS       Plenti_CMV_Puro_        9628 bp    DNA     circular SYN 26-DEC-2025
DEFINITION  Exported.
ACCESSION   V006757
VERSION     .
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 9628)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 9628)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9628)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9628
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     source          8832..8852
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        26..130
                     /label=AmpR promoter
     CDS             131..988
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      1162..1750
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     protein_bind    2038..2059
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        2074..2104
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    2112..2128
                     /label=lac operator
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     2136..2152
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     promoter        2173..2191
                     /label=T3 promoter
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        2219..2445
                     /label=RSV promoter
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             2446..2626
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    2673..2798
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    3291..3524
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             3709..3753
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             3902..3943
                     /label=Protein Tat
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     misc_feature    4020..4136
                     /label=cPPT/CTS
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     enhancer        4159..4462
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        4463..4666
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     protein_bind    4771..4895
                     /label=attR1
                     /note="recombination site for the Gateway(R) LR reaction"
     promoter        4920..4950
                     /label=lac UV5 promoter
                     /note="E. coli lac promoter with an 'up' mutation"
     CDS             5004..5660
                     /label=CmR
                     /note="chloramphenicol acetyltransferase"
     CDS             6005..6307
                     /label=ccdB
                     /note="CcdB, a bacterial toxin that poisons DNA gyrase"
     protein_bind    complement(6351..6475)
                     /label=attR2
                     /note="recombination site for the Gateway(R) LR reaction"
     misc_feature    6506..7094
                     /label=WPRE
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     promoter        7108..7607
                     /label=PGK promoter
                     /note="mouse phosphoglycerate kinase 1 promoter"
     CDS             7628..8224
                     /label=PuroR
                     /note="puromycin N-acetyltransferase"
     LTR             8365..8598
                     /label=3' LTR (Delta-U3)
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    8670..8804
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     rep_origin      8810..8966
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     rep_origin      8832..8852
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     promoter        complement(8987..9005)
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(9015..9031)
                     /label=M13 fwd
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     rep_origin      9173..9628
                     /direction=RIGHT
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"