Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V006757 | Plenti CMV Puro DEST | In stock, instant shipping |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
pLenti CMV Puro DEST is a lentiviral vector designed for high-efficiency gene delivery and stable expression in mammalian cells. It features a CMV promoter for strong constitutive expression, a puromycin resistance gene for selection in eukaryotic cells, and utilizes Gateway recombination technology for convenient cloning. The vector backbone includes an ampicillin resistance gene for propagation in E. coliand is approximately 9.6 kb in size. Please note that the cloning host is DB3.1.
- Vector Name:
- Plenti CMV Puro DEST
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9628 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Source/Author:
- Eric Campeau, Paul Kaufman
- Selection Marker:
- Puromycin
- Copy Number:
- High copy number
- Promoter:
- mPGK
- 5' Primer:
- CMV-F: CGCAAATGGGCGGTAGGCGTG
- Growth Strain(s):
- Top10
- Growth Temperature:
- 37℃
Plenti CMV Puro DEST vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Campeau E, Ruhl VE, Rodier F, Smith CL, Rahmberg BL, Fuss JO, Campisi J, Yaswen P, Cooper PK, Kaufman PD. A versatile viral system for expression and depletion of proteins in mammalian cells. PLoS One. 2009 Aug 6;4(8):e6529. doi: 10.1371/journal.pone.0006529. PMID: 19657394; PMCID: PMC2717805.
Plenti CMV Puro DEST vector Sequence
LOCUS Plenti_CMV_Puro_ 9628 bp DNA circular SYN 26-DEC-2025
DEFINITION Exported.
ACCESSION V006757
VERSION .
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 9628)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 9628)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9628)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9628
/mol_type="other DNA"
/organism="synthetic DNA construct"
source 8832..8852
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 26..130
/label=AmpR promoter
CDS 131..988
/label=AmpR
/note="beta-lactamase"
rep_origin 1162..1750
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
protein_bind 2038..2059
/label=CAP binding site
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 2074..2104
/label=lac promoter
/note="promoter for the E. coli lac operon"
protein_bind 2112..2128
/label=lac operator
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 2136..2152
/label=M13 rev
/note="common sequencing primer, one of multiple similar
variants"
promoter 2173..2191
/label=T3 promoter
/note="promoter for bacteriophage T3 RNA polymerase"
promoter 2219..2445
/label=RSV promoter
/note="Rous sarcoma virus enhancer/promoter"
LTR 2446..2626
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 2673..2798
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 3291..3524
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 3709..3753
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 3902..3943
/label=Protein Tat
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 4020..4136
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
enhancer 4159..4462
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 4463..4666
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
protein_bind 4771..4895
/label=attR1
/note="recombination site for the Gateway(R) LR reaction"
promoter 4920..4950
/label=lac UV5 promoter
/note="E. coli lac promoter with an 'up' mutation"
CDS 5004..5660
/label=CmR
/note="chloramphenicol acetyltransferase"
CDS 6005..6307
/label=ccdB
/note="CcdB, a bacterial toxin that poisons DNA gyrase"
protein_bind complement(6351..6475)
/label=attR2
/note="recombination site for the Gateway(R) LR reaction"
misc_feature 6506..7094
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
promoter 7108..7607
/label=PGK promoter
/note="mouse phosphoglycerate kinase 1 promoter"
CDS 7628..8224
/label=PuroR
/note="puromycin N-acetyltransferase"
LTR 8365..8598
/label=3' LTR (Delta-U3)
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 8670..8804
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
rep_origin 8810..8966
/label=SV40 ori
/note="SV40 origin of replication"
rep_origin 8832..8852
/label=SV40 ori
/note="SV40 origin of replication"
promoter complement(8987..9005)
/label=T7 promoter
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(9015..9031)
/label=M13 fwd
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 9173..9628
/direction=RIGHT
/label=f1 ori
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"