pgRNA-CKB vector (V006930)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V006930 pgRNA-CKB In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pgRNA-CKB
Antibiotic Resistance:
Ampicillin
Length:
9583 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Selection Marker:
Blasticidin
Copy Number:
High Copy
Promoter:
CAG
Cloning Method:
Restriction Enzyme
5' Primer:
CCTCTGCTAACCATGTTCATGC
3' Primer:
GATCTACCACATTTGTAGAG

pgRNA-CKB vector Map

pgRNA-CKB9583 bp400800120016002000240028003200360040004400480052005600600064006800720076008000840088009200Protein TatcPPT/CTSchimeric intronSV40 NLSSV40 NLSSV40 NLSmKate2Blasticidin-S deaminaseloxPWPREKS primer5' LTR (truncated)oriAmpRAmpR promoterCMV enhancerCMV promoterHIV-1 PsiRREgp41 peptide

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pgRNA-CKB vector Sequence

LOCUS       V006930                 9583 bp    DNA     circular SYN 03-JAN-2022
DEFINITION  Exported.
ACCESSION   V006930
VERSION     V006930
KEYWORDS    pgRNA-CKB
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9583)
  AUTHORS   Mandegar MA, Huebsch N, Frolov EB, Shin E, Truong A, Olvera MP, Chan
            AH, Miyaoka Y, Holmes K, Spencer CI, Judge LM, Gordon DE, Eskildsen
            TV, Villalta JE, Horlbeck MA, Gilbert LA, Krogan NJ, Sheikh SP,
            Weissman JS, Qi LS, So PL, Conklin BR
  TITLE     CRISPR Interference Efficiently Induces Specific and Reversible Gene
            Silencing in Human iPSCs.
  JOURNAL   Cell Stem Cell. 2016 Apr 7;18(4):541-53. doi:
            10.1016/j.stem.2016.01.022. Epub 2016 Mar 10.
   PUBMED   26971820
REFERENCE   2  (bases 1 to 9583)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9583)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1016/j.stem.2016.01.022"; journalName: "Cell Stem Cell"; date:
            "2016-04-7- 7"; volume: "18"; issue: "4"; pages: "541-53"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9583
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             160..201
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    309..426
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     intron          1636..2652
                     /label="chimeric intron"
                     /note="chimera between introns from chicken beta-actin and
                     rabbit beta-globin"
     CDS             2717..2737
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             2741..2761
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             2765..2785
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             2801..3496
                     /label="mKate2"
                     /note="monomeric far-red fluorescent protein (Shcherbo et
                     al., 2009)"
     CDS             3551..3970
                     /gene="bsr"
                     /label="Blasticidin-S deaminase"
                     /note="Blasticidin-S deaminase from Bacillus cereus.
                     Accession#: P33967"
     protein_bind    complement(4248..4281)
                     /label="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     misc_feature    4337..4925
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(4928..4944)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             5454..5634
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(5696..6284)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6458..7315)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7316..7420)
                     /label="AmpR promoter"
     enhancer        7686..8065
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        8066..8268
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     misc_feature    8510..8635
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    9132..9365
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             join(9550..9583,1..11)
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"