pPRIME-TET-GFP-FF3 vector (V006982)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V006982 pPRIME-TET-GFP-FF3 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

TET promoter (minimal CMV promoter containing seven upstream Tet-operator sites) transcribes GFP and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)

Vector Name:
pPRIME-TET-GFP-FF3
Antibiotic Resistance:
Ampicillin
Length:
8226 bp
Type:
Lentiviral vectors
Replication origin:
ori
Copy Number:
Low copy number
Promoter:
tight TRE
Cloning Method:
Enzyme digestion and ligation
5' Primer:
EGFP-C Forward: CATGGTCCTGCTGGAGTTCGTG
Fusion Tag:
GFP

pPRIME-TET-GFP-FF3 vector Map

pPRIME-TET-GFP-FF38226 bp400800120016002000240028003200360040004400480052005600600064006800720076008000CMV enhancerHIV-1 PsiRREgp41 peptideProtein TatcPPT/CTStight TRE promoterEGFP5' miR-30a3' miR-30acat promoterCmRMycWPREKS primer5' LTR (truncated)oriAmpRAmpR promoter

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pPRIME-TET-GFP-FF3 vector Sequence

LOCUS       V006982                 8226 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V006982
VERSION     V006982
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8226)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 8226)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8226
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        238..617
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     misc_feature    1023..1148
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1645..1878
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2063..2107
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2256..2297
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2405..2522
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2597..2911
                     /label="tight TRE promoter"
                     /note="Tet-responsive promoter PTight, consisting of seven
                     tet operator sequences followed by the minimal CMV
                     promoter"
     CDS             2928..3644
                     /label="EGFP"
                     /note="enhanced GFP"
     ncRNA           3697..3790
                     /label="5' miR-30a"
                     /note="sequence upstream of the 71-nt precursor of the
                     human miR-30a microRNA (Zeng et al., 2002)"
     ncRNA           3804..3916
                     /label="3' miR-30a"
                     /note="sequence downstream of the 71-nt precursor of the
                     human miR-30a microRNA (Zeng et al., 2002)"
     promoter        4069..4171
                     /label="cat promoter"
                     /note="promoter of the E. coli cat gene encoding
                     chloramphenicol acetyltransferase"
     CDS             4172..4828
                     /label="CmR"
                     /note="chloramphenicol acetyltransferase"
     CDS             4963..4992
                     /label="Myc"
                     /note="Myc (human c-Myc proto-oncogene) epitope tag"
     misc_feature    5115..5703
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(5706..5722)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             6232..6412
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(6474..7062)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(7236..8093)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(8094..8198)
                     /label="AmpR promoter"