BASU RaPID plasmid vector (V007044)

Price Information

Cat No. Plasmid Name Availability Add to cart
V007044 BASU RaPID plasmid In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
BASU RaPID plasmid
Antibiotic Resistance:
Ampicillin
Length:
12356 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Copy Number:
High Copy
Promoter:
SV40
Cloning Method:
Gibson Cloning
5' Primer:
CGC AAA TGG GCG GTA GGC GTG
3' Primer:
atatagacaaacgcacaccggcct

BASU RaPID plasmid vector Vector Map

BASU RaPID plasmid12356 bp600120018002400300036004200480054006000660072007800840090009600102001080011400120003' LTRHIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSBleoREM7 promoterCMV enhancerCMV promoterNESHAIRES2T2AmCherryWPRE3' LTR (Delta-U3)bGH poly(A) signalf1 oriSV40 promoterHygRSV40 poly(A) signalM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterSV40 poly(A) signal

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

BASU RaPID plasmid vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V007044                12356 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V007044
VERSION     V007044
KEYWORDS    BASU RaPID plasmid
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12356)
  AUTHORS   Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S,
            Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE,
            Khavari PA
  TITLE     RNA-protein interaction detection in living cells.
  JOURNAL   Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601.
   PUBMED   29400715
REFERENCE   2  (bases 1 to 12356)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 12356)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nat
            Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12356
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     LTR             1..634
                     /label="3' LTR"
                     /note="3' long terminal repeat (LTR) from HIV-1"
     misc_feature    681..806
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1303..1536
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1721..1765
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             1914..1955
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2063..2180
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     CDS             complement(2248..2619)
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     promoter        complement(2639..2686)
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     enhancer        2791..3094
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        3095..3298
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     primer_bind     3295..3319
                     /label="LNCX"
                     /note="Human CMV promoter, forward primer"
     CDS             3492..3518
                     /label="NES"
                     /note="nuclear export signal from the HIV Rev protein
                     (Fischer et al., 1995)"
     CDS             3528..3554
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     misc_feature    4358..4940
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             4939..5532
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     CDS             5542..5595
                     /codon_start=1
                     /product="2A peptide from Thosea asigna virus capsid
                     protein"
                     /label="T2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="EGRGSLLTCGDVEENPGP"
     CDS             5608..6315
                     /label="mCherry"
                     /note="monomeric derivative of DsRed fluorescent protein
                     (Shaner et al., 2004)"
     misc_feature    6331..6919
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             7126..7359
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    7466..7690
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      7736..8164
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        8178..8507
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             8556..9578
                     /label="HygR"
                     /note="aminoglycoside phosphotransferase from E. coli"
     polyA_signal    9711..9844
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(9881..9897)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(9881..9897)
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(9894..9916)
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     protein_bind    9905..9921
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(9929..9959)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(9974..9995)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(10112..10129)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(10283..10871)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(11045..11902)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(11903..12007)
                     /label="AmpR promoter"
     polyA_signal    12055..12189
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"