pCDH-CMV-MCS-EF1-copGFP vector (Cat. No.: V007087)
Note: The hEF1a promoter and the HTLV 5'LTR forms a composite promoter. hEF1a-HTLV promoter is a composite promoter comprising the human Elongation Factor-1α(EF-1α) core promoter and the R segment and part of the U5 sequence (R-U5’) of the Human T-Cell Leukemia Virus (HTLV) Type 1 Long Terminal Repeat. The EF-1α promoter exhibits a strong activity and yields long lasting expression of a transgene in vivo. The R-U5’ has been coupled to the EF-1α core promoter to enhance stability of RNA.
- Name:
- pCDH-CMV-MCS-EF1-copGFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7570 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Promoter:
- RSV
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- CMV-F: CGCAAATGGGCGGTAGGCGTG
- Fusion Tag:
- copGFP
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Meng Z, Tingru S, Jiaxin H, Yuechuan C, Xiaozhi L. [Construction of a eukaryotic expression vector of fibroblast activation protein and establishment of its stable over-expression in the oral squamous cell carcinoma]. Hua Xi Kou Qiang Yi Xue Za Zhi. 2017 Oct 1;35(5):468-472. Chinese. doi: 10.7518/hxkq.2017.05.004. PMID: 29188639; PMCID: PMC7030395.
pCDH-CMV-MCS-EF1-copGFP vector (Cat. No.: V007087) Sequence
LOCUS pCDH-CMV-MCS-EF1 7570 bp DNA circular SYN 26-DEC-2025
DEFINITION Exported.
ACCESSION V007087
VERSION .
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 7570)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 7570)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7570)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7570
/mol_type="other DNA"
/organism="synthetic DNA construct"
source 1797..1802
/mol_type="other DNA"
/organism="synthetic DNA construct"
source 4772..4792
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 6..232
/label=RSV promoter
/note="Rous sarcoma virus enhancer/promoter"
LTR 233..413
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 460..585
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1078..1311
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1496..1540
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1689..1730
/label=Protein Tat
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 1807..1923
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2013..2216
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
promoter 2357..2568
/label=EF-1-alpha core promoter
/note="core promoter for human elongation factor
EF-1-alpha"
LTR 2581..2849
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from human
T-cell leukemia virus (HTLV) type 1"
CDS 2905..3570
/label=CopGFP
/note="green fluorescent protein 2 from Pontellina plumata,
also known as ppluGFP2 (Shagin et al., 2004)"
misc_feature 3649..4237
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 4311..4544
/label=3' LTR (Delta-U3)
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 4616..4750
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
rep_origin 4756..4912
/label=SV40 ori
/note="SV40 origin of replication"
rep_origin 4772..4792
/label=SV40 ori
/note="SV40 origin of replication"
primer_bind complement(4946..4961)
/label=M13 rev
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(4969..4985)
/label=lac operator
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(4993..5023)
/label=lac promoter
/note="promoter for the E. coli lac operon"
protein_bind complement(5038..5059)
/label=CAP binding site
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(5347..5935)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6109..6966)
/label=AmpR
/note="beta-lactamase"
promoter complement(6967..7071)
/label=AmpR promoter
primer_bind 7545..7561
/label=M13 fwd
/note="common sequencing primer, one of multiple similar
variants"