pCDH-CMV-MCS-EF1-copGFP vector (Cat. No.: V007087)

pCDH-CMV-MCS-EF1-copGFP7570 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600690072007500RSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSCMV promoterEF-1-alpha core promoter5' LTR (truncated)CopGFPWPRE3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriM13 revlac operatorlac promoterCAP binding siteoriAmpRAmpR promoterM13 fwd
Basic Information

Note: The hEF1a promoter and the HTLV 5'LTR forms a composite promoter. hEF1a-HTLV promoter is a composite promoter comprising the human Elongation Factor-1α(EF-1α) core promoter and the R segment and part of the U5 sequence (R-U5’) of the Human T-Cell Leukemia Virus (HTLV) Type 1 Long Terminal Repeat. The EF-1α promoter exhibits a strong activity and yields long lasting expression of a transgene in vivo. The R-U5’ has been coupled to the EF-1α core promoter to enhance stability of RNA.

Name:
pCDH-CMV-MCS-EF1-copGFP
Antibiotic Resistance:
Ampicillin
Length:
7570 bp
Type:
Lentiviral vectors
Replication origin:
ori
Promoter:
RSV
Cloning Method:
Enzyme digestion and ligation
5' Primer:
CMV-F: CGCAAATGGGCGGTAGGCGTG
Fusion Tag:
copGFP
Growth Temperature:
37℃
$ 198.7
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Meng Z, Tingru S, Jiaxin H, Yuechuan C, Xiaozhi L. [Construction of a eukaryotic expression vector of fibroblast activation protein and establishment of its stable over-expression in the oral squamous cell carcinoma]. Hua Xi Kou Qiang Yi Xue Za Zhi. 2017 Oct 1;35(5):468-472. Chinese. doi: 10.7518/hxkq.2017.05.004. PMID: 29188639; PMCID: PMC7030395.

pCDH-CMV-MCS-EF1-copGFP vector (Cat. No.: V007087) Sequence

LOCUS       pCDH-CMV-MCS-EF1        7570 bp    DNA     circular SYN 26-DEC-2025
DEFINITION  Exported.
ACCESSION   V007087
VERSION     .
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7570)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 7570)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7570)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7570
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     source          1797..1802
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     source          4772..4792
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        6..232
                     /label=RSV promoter
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             233..413
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    460..585
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1078..1311
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             1496..1540
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             1689..1730
                     /label=Protein Tat
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     misc_feature    1807..1923
                     /label=cPPT/CTS
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2013..2216
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     promoter        2357..2568
                     /label=EF-1-alpha core promoter
                     /note="core promoter for human elongation factor
                     EF-1-alpha"
     LTR             2581..2849
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from human
                     T-cell leukemia virus (HTLV) type 1"
     CDS             2905..3570
                     /label=CopGFP
                     /note="green fluorescent protein 2 from Pontellina plumata,
                     also known as ppluGFP2 (Shagin et al., 2004)"
     misc_feature    3649..4237
                     /label=WPRE
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             4311..4544
                     /label=3' LTR (Delta-U3)
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    4616..4750
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     rep_origin      4756..4912
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     rep_origin      4772..4792
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     primer_bind     complement(4946..4961)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     protein_bind    complement(4969..4985)
                     /label=lac operator
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4993..5023)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(5038..5059)
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(5347..5935)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(6109..6966)
                     /label=AmpR
                     /note="beta-lactamase"
     promoter        complement(6967..7071)
                     /label=AmpR promoter
     primer_bind     7545..7561
                     /label=M13 fwd
                     /note="common sequencing primer, one of multiple similar 
                     variants"