Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V007150 | pLBH559_Tet-HisCas14a1Locus | In stock, instant shipping |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
pLBH559_Tet-HisCas14a1Locus provides the Cas14a1 gene for experimental use, facilitating its cloning into pET28a, induction of expression, and purification of the Cas14a1 protein for nucleic acid diagnosis of spinal muscular atrophy.
- Vector Name:
- pLBH559_Tet-HisCas14a1Locus
- Antibiotic Resistance:
- Chloramphenicol
- Length:
- 4670 bp
- Type:
- Bacterial Expression, CRISPR
- Replication origin:
- p15A ori
- Copy Number:
- Low Copy
- Promoter:
- Tet
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- gtgccgatcaacgtAtcattttcg
- 3' Primer:
- acgcagaaaggcccacccgaag
- Growth Strain(s):
- JM109
pLBH559_Tet-HisCas14a1Locus vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Hu Z, Chen M, Zhang C, Li Z, Feng M, Wu L, Zhou M, Liang D. Cas14a1-Mediated Nucleic Acid Diagnostics for Spinal Muscular Atrophy. Biosensors (Basel). 2022 Apr 23;12(5):268. doi: 10.3390/bios12050268. PMID: 35624569; PMCID: PMC9138763.
pLBH559_Tet-HisCas14a1Locus vector Sequence
LOCUS V007150 4670 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V007150
VERSION V007150
KEYWORDS pLBH559_Tet-HisCas14a1Locus
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 4670)
AUTHORS Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP,
Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA
TITLE Programmed DNA destruction by miniature CRISPR-Cas14 enzymes.
JOURNAL Science. 2018 Oct 18. pii: science.aav4294. doi:
10.1126/science.aav4294.
PUBMED 30337455
REFERENCE 2 (bases 1 to 4670)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 4670)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Science.
2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..4670
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 16..71
/label="tetR/tetA promoters"
/note="overlapping promoters for bacterial tetR and tetA"
RBS 89..100
/note="strong bacterial ribosome binding site (Elowitz and
Leibler, 2000)"
CDS 116..133
/label="6xHis"
/note="6xHis affinity tag"
CDS 134..154
/label="TEV site"
/note="tobacco etch virus (TEV) protease recognition and
cleavage site"
CDS 170..1756
/gene="cas12f"
/label="CRISPR-associated endodeoxyribonuclease Cas12f1"
/note="CRISPR-associated endodeoxyribonuclease Cas12f1 from
Uncultured archaeon. Accession#: A0A482D308"
terminator 2289..2316
/label="T7Te terminator"
/note="phage T7 early transcription terminator"
primer_bind complement(2344..2361)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(2478..3023)
/direction=LEFT
/label="p15A ori"
/note="Plasmids containing the medium-copy-number p15A
origin of replication can be propagated in E. coli cells
that contain a second plasmid with the ColE1 origin."
terminator complement(3137..3231)
/label="lambda t0 terminator"
/note="transcription terminator from phage lambda"
CDS complement(3255..3911)
/label="CmR"
/note="chloramphenicol acetyltransferase"
promoter complement(3912..4014)
/label="cat promoter"
/note="promoter of the E. coli cat gene encoding
chloramphenicol acetyltransferase"
CDS complement(4047..4670)
/label="TetR"
/note="tetracycline repressor TetR"