CHOP promoter (-649/+136) pmCherry-1 vector (Cat. No.: V012177)
- Name:
- CHOP promoter (-649/+136) pmCherry-1
- Antibiotic Resistance:
- Kanamycin
- Length:
- 4880 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Selection Marker:
- Neomycin (select with G418)
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- custom: GGCCTTTTGCTCACATGTTC
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
CHOP promoter (-649/+136) pmCherry-1 vector (Cat. No.: V012177) Sequence
LOCUS V012177 4880 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V012177
VERSION V012177
KEYWORDS CHOP promoter (-649/+136) pmCherry-1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 4880)
AUTHORS Oh RS, Pan WC, Yalcin A, Zhang H, Guilarte TR, Hotamisligil GS,
Christiani DC, Lu Q
TITLE Functional RNA Interference (RNAi) Screen Identifies System A
Neutral Amino Acid Transporter 2 (SNAT2) as a Mediator of
Arsenic-induced Endoplasmic Reticulum Stress.
JOURNAL J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3.
PUBMED 22215663
REFERENCE 2 (bases 1 to 4880)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 4880)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "J Biol
Chem."; date: "2012-02-17"; volume: "287(8)"; pages: "6025-34. Epub
2012 Jan 3"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..4880
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 711..812
/gene="DDIT3"
/label="DDIT3 upstream open reading frame protein"
/note="DDIT3 upstream open reading frame protein from Homo
sapiens. Accession#: P0DPQ6"
CDS 837..1544
/label="mCherry"
/note="monomeric derivative of DsRed fluorescent protein
(Shaner et al., 2004)"
polyA_signal 1668..1789
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin complement(1796..2251)
/direction=LEFT
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 2278..2382
/label="AmpR promoter"
promoter 2384..2741
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
CDS 2776..3567
/label="NeoR/KanR"
/note="aminoglycoside phosphotransferase"
primer_bind complement(3758..3777)
/label="TK-pA-R"
/note="Thymidine kinase polyA, reverse primer"
polyA_signal 3802..3849
/label="HSV TK poly(A) signal"
/note="herpes simplex virus thymidine kinase
polyadenylation signal (Cole and Stacy, 1985)"
rep_origin 4178..4766
/direction=RIGHT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"