CHOP promoter (-649/+136) pmCherry-1 vector (Cat. No.: V012177)

CHOP promoter (-649/+136) pmCherry-14880 bp6001200180024003000360042004800DDIT3mCherrySV40 poly(A) signalf1 oriAmpR promoterSV40 promoterNeoR/KanRTK-pA-RHSV TK poly(A) signalori
Basic Information
Name:
CHOP promoter (-649/+136) pmCherry-1
Antibiotic Resistance:
Kanamycin
Length:
4880 bp
Type:
Mammalian Expression
Replication origin:
ori
Selection Marker:
Neomycin (select with G418)
Copy Number:
High Copy
Promoter:
SV40
Cloning Method:
Restriction Enzyme
5' Primer:
custom: GGCCTTTTGCTCACATGTTC
$ 198.7
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

CHOP promoter (-649/+136) pmCherry-1 vector (Cat. No.: V012177) Sequence

LOCUS       V012177                 4880 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012177
VERSION     V012177
KEYWORDS    CHOP promoter (-649/+136) pmCherry-1
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 4880)
  AUTHORS   Oh RS, Pan WC, Yalcin A, Zhang H, Guilarte TR, Hotamisligil GS,
            Christiani DC, Lu Q
  TITLE     Functional RNA Interference (RNAi) Screen Identifies System A
            Neutral Amino Acid Transporter 2 (SNAT2) as a Mediator of
            Arsenic-induced Endoplasmic Reticulum Stress.
  JOURNAL   J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3.
   PUBMED   22215663
REFERENCE   2  (bases 1 to 4880)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 4880)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "J Biol
            Chem."; date: "2012-02-17"; volume: "287(8)"; pages: "6025-34. Epub
            2012 Jan 3"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..4880
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             711..812
                     /gene="DDIT3"
                     /label="DDIT3 upstream open reading frame protein"
                     /note="DDIT3 upstream open reading frame protein from Homo
                     sapiens. Accession#: P0DPQ6"
     CDS             837..1544
                     /label="mCherry"
                     /note="monomeric derivative of DsRed fluorescent protein
                     (Shaner et al., 2004)"
     polyA_signal    1668..1789
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      complement(1796..2251)
                     /direction=LEFT
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2278..2382
                     /label="AmpR promoter"
     promoter        2384..2741
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             2776..3567
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     primer_bind     complement(3758..3777)
                     /label="TK-pA-R"
                     /note="Thymidine kinase polyA, reverse primer"
     polyA_signal    3802..3849
                     /label="HSV TK poly(A) signal"
                     /note="herpes simplex virus thymidine kinase
                     polyadenylation signal (Cole and Stacy, 1985)"
     rep_origin      4178..4766
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"