Basic Vector Information
- Vector Name:
- CHOP promoter (-649/+136) pmCherry-1
- Antibiotic Resistance:
- Kanamycin
- Length:
- 4880 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Selection Marker:
- Neomycin (select with G418)
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- custom: GGCCTTTTGCTCACATGTTC
CHOP promoter (-649/+136) pmCherry-1 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
CHOP promoter (-649/+136) pmCherry-1 vector Sequence
LOCUS CHOP_promoter_(- 4880 bp DNA circular SYN 13-MAY-2021
DEFINITION synthetic circular DNA.
ACCESSION .
VERSION .
KEYWORDS CHOP promoter (-649/+136) pmCherry-1.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 4880)
AUTHORS Oh RS, Pan WC, Yalcin A, Zhang H, Guilarte TR, Hotamisligil GS,
Christiani DC, Lu Q
TITLE Functional RNA Interference (RNAi) Screen Identifies System A
Neutral Amino Acid Transporter 2 (SNAT2) as a Mediator of
Arsenic-induced Endoplasmic Reticulum Stress.
JOURNAL J Biol Chem. 2012 Feb 17;287(8):6025-34. Epub 2012 Jan 3.
PUBMED 22215663
REFERENCE 2 (bases 1 to 4880)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 4880)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "J Biol
Chem."; date: "2012-02-17"; volume: "287(8)"; pages: "6025-34. Epub
2012 Jan 3"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..4880
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 711..812
/gene="DDIT3"
/label=DDIT3
/note="DDIT3 upstream open reading frame protein from Homo
sapiens. Accession#: P0DPQ6"
CDS 837..1544
/label=mCherry
/note="monomeric derivative of DsRed fluorescent protein
(Shaner et al., 2004)"
polyA_signal 1668..1789
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
rep_origin complement(1796..2251)
/direction=LEFT
/label=f1 ori
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 2278..2382
/label=AmpR promoter
promoter 2384..2741
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
CDS 2776..3567
/label=NeoR/KanR
/note="aminoglycoside phosphotransferase"
primer_bind complement(3758..3777)
/label=TK-pA-R
/note="Thymidine kinase polyA, reverse primer"
polyA_signal 3802..3849
/label=HSV TK poly(A) signal
/note="herpes simplex virus thymidine kinase
polyadenylation signal (Cole and Stacy, 1985)"
rep_origin 4178..4766
/direction=RIGHT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
This page is informational only.