pBACi vector (V009319)

LOCUS       V009319                 9274 bp    DNA     circular SYN 17-DEC-2018
DEFINITION  Exported.
ACCESSION   V009319
VERSION     V009319
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9274)
  AUTHORS   Sato'o Y, Hisatsune J, Sakuma T, Yamamoto T, Sugai M.
  TITLE     Novel CRISPR interference technology, an elementary method for
            inspects of Staphylococcus aureus clinical isolates
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 9274)
  AUTHORS   Sato'o Y, Hisatsune J, Sugai M.
  TITLE     Direct Submission
  JOURNAL   Submitted (22-FEB-2016) Contact:Motoyuki Sugai Hiroshima University,
            Bacteriology; Minamiku, Kasumi1-2-3, Hiroshima, Hiroshima 734-8551,
            Japan URL :http://home.hiroshima-u.ac.jp/saikin/index.html
REFERENCE   3  (bases 1 to 9274)
  TITLE     Direct Submission
REFERENCE   4  (bases 1 to 9274)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     ##Assembly-Data-START##
            Assembly Method       :: CLC Genomics Workbench v. 7
            Sequencing Technology :: Illumina MiSeq
            ##Assembly-Data-END##
            SGRef: number: 1; type: "Journal Article"; journalName:
            "Unpublished"
            SGRef: number: 2; type: "Journal Article"; journalName: "Submitted
            (22-FEB-2016) Contact:Motoyuki Sugai Hiroshima University,
            Bacteriology"; volume: " Minamiku, Kasumi1-2-3, Hiroshima, Hiroshima
            734-8551, Japan URL :http"; pages:
            "//home.hiroshima-u.ac.jp/saikin/index.htm"
            SGRef: number: 3; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9274
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     protein_bind    1..22
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        37..67
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    75..91
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     99..115
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     repeat_region   414..449
                     /rpt_unit_seq="gttttagagctatgctgttttgaatggtcccaaaac"
     misc_feature    complement(450..455)
                     /label="BsaI recognition site"
                     /note="BsaI recognition site"
     misc_feature    473..478
                     /label="BsaI recognition site"
                     /note="BsaI recognition site"
     repeat_region   480..515
                     /label="DR"
                     /note="direct repeat for the Streptococcus pyogenes
                     CRISPR/Cas system"
     misc_feature    complement(516..647)
                     /label="crRNA leader"
                     /note="crRNA leader sequence for the Streptococcus pyogenes
                     CRISPR/Cas system"
     CDS             complement(671..4774)
                     /label="dCas9"
                     /note="catalytically dead mutant of the Cas9 endonuclease
                     from the Streptococcus pyogenes Type II CRISPR/Cas system"
     misc_RNA        5070..5148
                     /label="tracrRNA"
                     /note="trans-activating CRISPR RNA for the Streptococcus
                     pyogenes CRISPR/Cas9 system"
     primer_bind     complement(5456..5472)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     rep_origin      5823..6411
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6988..7635)
                     /gene="cat"
                     /label="Chloramphenicol acetyltransferase"
                     /note="Chloramphenicol acetyltransferase from
                     Staphylococcus aureus. Accession#: P00485"
     CDS             complement(7917..8918)
                     /label="repB"
                     /note="RepB replication protein"