AAVS1 T2 CRIPR in pX330 vector (V000388)

Basic Vector Information

      • Vector Name:
      • AAVS1 T2 CRIPR in pX330
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 8507 bp
      • Type:
      • Mammalian Expression, CRISPR
      • Copy Number:
      • High Copy
      • Promoter:
      • U6 promoter
      • Cloning Method:
      • Restriction Enzyme
      • 5' Primer:
      • aggctgttagagagataattgg

AAVS1 T2 CRIPR in pX330 vector Vector Map

AAVS1 T2 CRIPR in pX3308507 bp4008001200160020002400280032003600400044004800520056006000640068007200760080008400U6 promotergRNA scaffoldCMV enhancerhybrid intronKozak sequence3xFLAGSV40 NLSCas9nucleoplasmin NLSBGH-revAAV2 ITRf1 oripRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRori

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

AAVS1 T2 CRIPR in pX330 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported                8507 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  CRISPR/Cas to target the AAVS1 locus in human cells.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 8507)
  AUTHORS   Natsume T, Kiyomitsu T, Saga Y, Kanemaki MT
  TITLE     Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron 
            Tagging with Short Homology Donors.
  JOURNAL   Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001.
            Epub 2016 Mar 24.
  PUBMED    27052166
REFERENCE   2  (bases 1 to 8507)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1016/j.celrep.2016.03.001"; journalName: "Cell Rep"; date: 
            "2016-04-5- 5"; volume: "15"; issue: "1"; pages: "210-8"
FEATURES             Location/Qualifiers
     source          1..8507
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        1..241
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     primer_bind     1..21
                     /note="Human U6 promoter, forward primer"
     primer_bind     172..191
                     /label=LKO.1 5'
                     /note="Human U6 promoter, forward primer"
     misc_RNA        270..345
                     /label=gRNA scaffold
                     /note="guide RNA scaffold for the Streptococcus pyogenes 
                     CRISPR/Cas9 system"
     enhancer        442..727
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer; 
                     contains an 18-bp deletion relative to the standard CMV 
     intron          1007..1234
                     /label=hybrid intron
                     /note="hybrid between chicken beta-actin (CBA) and minute 
                     virus of mice (MMV) introns (Gray et al., 2011)"
     regulatory      1246..1255
                     /label=Kozak sequence
                     /note="vertebrate consensus sequence for strong initiation 
                     of translation (Kozak, 1987)"
     CDS             1255..1320
                     /product="three tandem FLAG(R) epitope tags, followed by an
                     enterokinase cleavage site"
     CDS             1327..1347
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             1372..5472
                     /product="Cas9 (Csn1) endonuclease from the Streptococcus 
                     pyogenes Type II CRISPR/Cas system"
                     /note="generates RNA-guided double strand breaks in DNA"
     CDS             5473..5520
                     /product="bipartite nuclear localization signal from 
                     /label=nucleoplasmin NLS
     primer_bind     complement(5548..5565)
                     /note="Bovine growth hormone terminator, reverse primer. 
                     Also called BGH reverse"
     polyA_signal    5554..5761
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     repeat_region   5770..5910
                     /label=AAV2 ITR
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     repeat_region   5770..5899
                     /label=AAV2 ITR
     rep_origin      5985..6440
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(6072..6091)
                     /note="F1 origin, reverse primer"
     primer_bind     6282..6303
                     /note="F1 origin, forward primer"
     primer_bind     complement(6457..6476)
                     /note="pRS vectors, use to sequence yeast selectable 
     primer_bind     6576..6598
                     /label=pGEX 3'
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(6636..6654)
                     /note="pBR322 vectors, upsteam of EcoRI site, forward 
     promoter        6722..6826
                     /label=AmpR promoter
     CDS             6827..7687
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     complement(7045..7064)
                     /note="Ampicillin resistance gene, reverse primer"
     rep_origin      7858..8446
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     8347..8366
                     /note="pBR322 origin, forward primer"

This page is informational only.