ER50-SpCas9-ER50 vector (Cat. No.: V012207)

ER50-SpCas9-ER5010000 bp500100015002000250030003500400045005000550060006500700075008000850090009500U6 promotergRNA scaffoldCMV enhancerchicken beta-actin promoterhybrid intron3xFLAGSV40 NLSEstrogen receptorCas9nucleoplasmin NLSbGH poly(A) signalAAV2 ITRf1 oripRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRori
Basic Information
Name:
ER50-SpCas9-ER50
Antibiotic Resistance:
Ampicillin
Length:
10000 bp
Type:
Mammalian Expression, AAV
Replication origin:
ori
Copy Number:
High Copy
Promoter:
CBh
Cloning Method:
Gibson Cloning
5' Primer:
agcgaagcgcgcggcgggcg
3' Primer:
TAGAAGGCACAGTCGAGG
$ 198.7
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

ER50-SpCas9-ER50 vector (Cat. No.: V012207) Sequence

LOCUS       V012207                10000 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012207
VERSION     V012207
KEYWORDS    ER50-SpCas9-ER50
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 10000)
  AUTHORS   Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD,
            Choudhary A
  TITLE     Multidimensional chemical control of CRISPR-Cas9.
  JOURNAL   Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub
            2016 Oct 31.
   PUBMED   27820801
REFERENCE   2  (bases 1 to 10000)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 10000)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1038/nchembio.2224"; journalName: "Nat Chem Biol"; date:
            "2017-01"; volume: "13"; issue: "1"; pages: "9-11"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10000
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        1..241
                     /label="U6 promoter"
                     /note="RNA polymerase III promoter for human U6 snRNA"
     misc_RNA        268..343
                     /label="gRNA scaffold"
                     /note="guide RNA scaffold for the Streptococcus pyogenes
                     CRISPR/Cas9 system"
     enhancer        440..725
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer;
                     contains an 18-bp deletion relative to the standard CMV
                     enhancer"
     promoter        727..1004
                     /label="chicken beta-actin promoter"
     intron          1005..1233
                     /label="hybrid intron"
                     /note="hybrid between chicken beta-actin (CBA) and minute
                     virus of mice (MMV) introns (Gray et al., 2011)"
     regulatory      1245..1254
                     /label="Kozak sequence"
                     /note="vertebrate consensus sequence for strong initiation
                     of translation (Kozak, 1987)"
                     /regulatory_class="other"
     CDS             1254..1319
                     /label="3xFLAG"
                     /note="three tandem FLAG(R) epitope tags, followed by an
                     enterokinase cleavage site"
     CDS             1326..1346
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             1671..2033
                     /gene="ESR1"
                     /label="Estrogen receptor"
                     /note="Estrogen receptor from Macaca mulatta. Accession#:
                     P49886"
     CDS             2130..6230
                     /label="Cas9"
                     /note="Cas9 (Csn1) endonuclease from the Streptococcus
                     pyogenes Type II CRISPR/Cas system"
     CDS             6231..6278
                     /codon_start=1
                     /product="bipartite nuclear localization signal from
                     nucleoplasmin"
                     /label="nucleoplasmin NLS"
                     /translation="KRPAATKKAGQAKKKK"
     polyA_signal    7047..7254
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     repeat_region   7263..7403
                     /label="AAV2 ITR"
                     /note="inverted terminal repeat of adeno-associated virus
                     serotype 2"
     rep_origin      7478..7933
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(7950..7969)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     primer_bind     8069..8091
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(8129..8147)
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"
     promoter        8215..8319
                     /label="AmpR promoter"
     CDS             8320..9177
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      9351..9939
                     /direction=RIGHT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"