Basic Vector Information
- Vector Name:
- ER50-SpCas9-ER50
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10000 bp
- Type:
- Mammalian Expression, AAV
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CBh
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- agcgaagcgcgcggcgggcg
- 3' Primer:
- TAGAAGGCACAGTCGAGG
ER50-SpCas9-ER50 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
ER50-SpCas9-ER50 vector Sequence
LOCUS ER50-SpCas9-ER50 10000 bp DNA circular SYN 13-MAY-2021
DEFINITION Expresses SpCas9 fused to ER50 domain on both N- and C-termini in
mammalian cells.
ACCESSION .
VERSION .
KEYWORDS ER50-SpCas9-ER50.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 10000)
AUTHORS Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD,
Choudhary A
TITLE Multidimensional chemical control of CRISPR-Cas9.
JOURNAL Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub
2016 Oct 31.
PUBMED 27820801
REFERENCE 2 (bases 1 to 10000)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 10000)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1038/nchembio.2224"; journalName: "Nat Chem Biol"; date:
"2017-01"; volume: "13"; issue: "1"; pages: "9-11"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10000
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 1..241
/label=U6 promoter
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 268..343
/label=gRNA scaffold
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
enhancer 440..725
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer;
contains an 18-bp deletion relative to the standard CMV
enhancer"
promoter 727..1004
/label=chicken beta-actin promoter
intron 1005..1233
/label=hybrid intron
/note="hybrid between chicken beta-actin (CBA) and minute
virus of mice (MMV) introns (Gray et al., 2011)"
regulatory 1245..1254
/label=Kozak sequence
/note="vertebrate consensus sequence for strong initiation
of translation (Kozak, 1987)"
/regulatory_class="other"
CDS 1254..1319
/label=3xFLAG
/note="three tandem FLAG(R) epitope tags, followed by an
enterokinase cleavage site"
CDS 1326..1346
/label=SV40 NLS
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 1671..2033
/gene="ESR1"
/label=ESR1
/note="Estrogen receptor from Macaca mulatta. Accession#:
P49886"
CDS 2130..6230
/label=Cas9
/note="Cas9 (Csn1) endonuclease from the Streptococcus
pyogenes Type II CRISPR/Cas system"
CDS 6231..6278
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label=nucleoplasmin NLS
/translation="KRPAATKKAGQAKKKK"
polyA_signal 7047..7254
/label=bGH poly(A) signal
/note="bovine growth hormone polyadenylation signal"
repeat_region 7263..7403
/label=AAV2 ITR
/note="inverted terminal repeat of adeno-associated virus
serotype 2"
rep_origin 7478..7933
/label=f1 ori
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
primer_bind complement(7950..7969)
/label=pRS-marker
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 8069..8091
/label=pGEX 3'
/note="pGEX vectors, reverse primer"
primer_bind complement(8129..8147)
/label=pBRforEco
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 8215..8319
/label=AmpR promoter
CDS 8320..9177
/label=AmpR
/note="beta-lactamase"
rep_origin 9351..9939
/direction=RIGHT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
This page is informational only.