Cart 2

ER50-SpCas9-ER50 vector (V012207#)

Basic Vector Information

Basic Vector Information
Vector Name ER50-SpCas9-ER50 Antibiotic Resistance Ampicillin
Length 10000 bp Type Mammalian Expression, AAV
Copy Number High Copy Promoter Cbh
Cloning Method Gibson Cloning 5' Primer agcgaagcgcgcggcgggcg

ER50-SpCas9-ER50 vector Vector Map

ER50-SpCas9-ER5010000 bp500100015002000250030003500400045005000550060006500700075008000850090009500U6 promotergRNA scaffoldCMV enhancerchicken beta-actin promoterhybrid intronKozak sequence3xFLAGSV40 NLSCas9nucleoplasmin NLSBGH-revAAV2 ITRf1 oripRS-markerpGEX 3'pBRforEcoAmpR promoterAmpRori

Plasmid Resuspension protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

ER50-SpCas9-ER50 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported               10000 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  Expresses SpCas9 fused to ER50 domain on both N- and C-termini in 
            mammalian cells.
KEYWORDS    ER50-SpCas9-ER50
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 10000)
  AUTHORS   Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD, 
            Choudhary A
  TITLE     Multidimensional chemical control of CRISPR-Cas9.
  JOURNAL   Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub
            2016 Oct 31.
  PUBMED    27820801
REFERENCE   2  (bases 1 to 10000)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1038/nchembio.2224"; journalName: "Nat Chem Biol"; date: 
            "2017-01"; volume: "13"; issue: "1"; pages: "9-11"
FEATURES             Location/Qualifiers
     source          1..10000
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     promoter        1..241
                     /label=U6 promoter
                     /note="RNA polymerase III promoter for human U6 snRNA"
     primer_bind     1..21
                     /note="Human U6 promoter, forward primer"
     primer_bind     172..191
                     /label=LKO.1 5'
                     /note="Human U6 promoter, forward primer"
     misc_RNA        268..343
                     /label=gRNA scaffold
                     /note="guide RNA scaffold for the Streptococcus pyogenes 
                     CRISPR/Cas9 system"
     enhancer        440..725
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer; 
                     contains an 18-bp deletion relative to the standard CMV 
     promoter        727..1004
                     /label=chicken beta-actin promoter
     intron          1005..1233
                     /label=hybrid intron
                     /note="hybrid between chicken beta-actin (CBA) and minute 
                     virus of mice (MMV) introns (Gray et al., 2011)"
     regulatory      1245..1254
                     /label=Kozak sequence
                     /note="vertebrate consensus sequence for strong initiation 
                     of translation (Kozak, 1987)"
     CDS             1254..1319
                     /product="three tandem FLAG(R) epitope tags, followed by an
                     enterokinase cleavage site"
     CDS             1326..1346
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             2130..6230
                     /product="Cas9 (Csn1) endonuclease from the Streptococcus 
                     pyogenes Type II CRISPR/Cas system"
                     /note="generates RNA-guided double strand breaks in DNA"
     CDS             6231..6278
                     /product="bipartite nuclear localization signal from 
                     /label=nucleoplasmin NLS
     primer_bind     complement(7041..7058)
                     /note="Bovine growth hormone terminator, reverse primer. 
                     Also called BGH reverse"
     polyA_signal    7047..7254
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     repeat_region   7263..7403
                     /label=AAV2 ITR
                     /note="inverted terminal repeat of adeno-associated virus 
                     serotype 2"
     repeat_region   7263..7392
                     /label=AAV2 ITR
     rep_origin      7478..7933
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(7565..7584)
                     /note="F1 origin, reverse primer"
     primer_bind     7775..7796
                     /note="F1 origin, forward primer"
     primer_bind     complement(7950..7969)
                     /note="pRS vectors, use to sequence yeast selectable 
     primer_bind     8069..8091
                     /label=pGEX 3'
                     /note="pGEX vectors, reverse primer"
     primer_bind     complement(8129..8147)
                     /note="pBR322 vectors, upsteam of EcoRI site, forward 
     promoter        8215..8319
                     /label=AmpR promoter
     CDS             8320..9180
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     complement(8538..8557)
                     /note="Ampicillin resistance gene, reverse primer"
     rep_origin      9351..9939
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     9840..9859
                     /note="pBR322 origin, forward primer"

This page is informational only.