ER50-SpCas9-ER50 vector (Cat. No.: V012207)
- Name:
- ER50-SpCas9-ER50
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10000 bp
- Type:
- Mammalian Expression, AAV
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CBh
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- agcgaagcgcgcggcgggcg
- 3' Primer:
- TAGAAGGCACAGTCGAGG
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
ER50-SpCas9-ER50 vector (Cat. No.: V012207) Sequence
LOCUS V012207 10000 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V012207
VERSION V012207
KEYWORDS ER50-SpCas9-ER50
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10000)
AUTHORS Maji B, Moore CL, Zetsche B, Volz SE, Zhang F, Shoulders MD,
Choudhary A
TITLE Multidimensional chemical control of CRISPR-Cas9.
JOURNAL Nat Chem Biol. 2017 Jan;13(1):9-11. doi: 10.1038/nchembio.2224. Epub
2016 Oct 31.
PUBMED 27820801
REFERENCE 2 (bases 1 to 10000)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 10000)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1038/nchembio.2224"; journalName: "Nat Chem Biol"; date:
"2017-01"; volume: "13"; issue: "1"; pages: "9-11"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10000
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 1..241
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 268..343
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
enhancer 440..725
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer;
contains an 18-bp deletion relative to the standard CMV
enhancer"
promoter 727..1004
/label="chicken beta-actin promoter"
intron 1005..1233
/label="hybrid intron"
/note="hybrid between chicken beta-actin (CBA) and minute
virus of mice (MMV) introns (Gray et al., 2011)"
regulatory 1245..1254
/label="Kozak sequence"
/note="vertebrate consensus sequence for strong initiation
of translation (Kozak, 1987)"
/regulatory_class="other"
CDS 1254..1319
/label="3xFLAG"
/note="three tandem FLAG(R) epitope tags, followed by an
enterokinase cleavage site"
CDS 1326..1346
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 1671..2033
/gene="ESR1"
/label="Estrogen receptor"
/note="Estrogen receptor from Macaca mulatta. Accession#:
P49886"
CDS 2130..6230
/label="Cas9"
/note="Cas9 (Csn1) endonuclease from the Streptococcus
pyogenes Type II CRISPR/Cas system"
CDS 6231..6278
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label="nucleoplasmin NLS"
/translation="KRPAATKKAGQAKKKK"
polyA_signal 7047..7254
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
repeat_region 7263..7403
/label="AAV2 ITR"
/note="inverted terminal repeat of adeno-associated virus
serotype 2"
rep_origin 7478..7933
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
primer_bind complement(7950..7969)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 8069..8091
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind complement(8129..8147)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 8215..8319
/label="AmpR promoter"
CDS 8320..9177
/label="AmpR"
/note="beta-lactamase"
rep_origin 9351..9939
/direction=RIGHT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"