pMA2775 vector (V012221)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V012221 pMA2775 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pMA2775
Antibiotic Resistance:
Ampicillin
Length:
7545 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
tight TRE
Cloning Method:
Restriction Enzyme
5' Primer:
ctatagtgaatagagttagg

pMA2775 vector Map

pMA27757545 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600690072007500pRS-markerCMV enhancerCMV-FHIV-1 PsiRREgp41 peptideProtein TatcPPT/CTStight TRE promoterMycExodeoxyribonuclease IIISK primerSV40 promoterPuroR5' LTR (truncated)oriAmpRAmpR promoter

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pMA2775 vector Sequence

LOCUS       V012221                 7545 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012221
VERSION     V012221
KEYWORDS    pMA2775
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7545)
  AUTHORS   Shokolenko IN, Wilson GL, Alexeyev MF
  TITLE     Persistent damage induces mitochondrial DNA degradation.
  JOURNAL   DNA Repair (Amst). 2013 Jul;12(7):488-99. doi:
            10.1016/j.dnarep.2013.04.023. Epub 2013 May 27.
   PUBMED   23721969
REFERENCE   2  (bases 1 to 7545)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7545)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1016/j.dnarep.2013.04.023"; journalName: "DNA Repair (Amst)";
            date: "2013-07"; volume: "12"; issue: "7"; pages: "488-99"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7545
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     primer_bind     complement(51..70)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     enhancer        246..629
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     primer_bind     784..804
                     /label="CMV-F"
                     /note="Human CMV immediate early promoter, forward primer"
     misc_feature    1035..1160
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1657..1890
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2075..2119
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2268..2309
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2413..2530
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     primer_bind     complement(2629..2645)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        2645..2959
                     /label="tight TRE promoter"
                     /note="Tet-responsive promoter PTight, consisting of seven
                     tet operator sequences followed by the minimal CMV
                     promoter"
     CDS             3073..3102
                     /label="Myc"
                     /note="Myc (human c-Myc proto-oncogene) epitope tag"
     CDS             3109..3909
                     /gene="xthA"
                     /label="Exodeoxyribonuclease III"
                     /note="Exodeoxyribonuclease III from Escherichia coli
                     (strain K12). Accession#: P09030"
     primer_bind     3921..3937
                     /label="SK primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        3991..4320
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     CDS             4334..4930
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     LTR             5551..5731
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(5793..6381)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6555..7412)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7413..7517)
                     /label="AmpR promoter"