Basic Vector Information
- Vector Name:
- pMA2775
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7545 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- tight TRE
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- ctatagtgaatagagttagg
pMA2775 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pMA2775 vector Sequence
LOCUS pMA2775. 7545 bp DNA circular SYN 13-MAY-2021
DEFINITION Lentiviral vector encoding Tet-inducible mitochondrially targeted
myc-tagged E.coli exonuclease III.
ACCESSION .
VERSION .
KEYWORDS pMA2775.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 7545)
AUTHORS Shokolenko IN, Wilson GL, Alexeyev MF
TITLE Persistent damage induces mitochondrial DNA degradation.
JOURNAL DNA Repair (Amst). 2013 Jul;12(7):488-99. doi:
10.1016/j.dnarep.2013.04.023. Epub 2013 May 27.
PUBMED 23721969
REFERENCE 2 (bases 1 to 7545)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7545)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1016/j.dnarep.2013.04.023"; journalName: "DNA Repair (Amst)";
date: "2013-07"; volume: "12"; issue: "7"; pages: "488-99"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7545
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind complement(51..70)
/label=pRS-marker
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 246..629
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
primer_bind 784..804
/label=CMV-F
/note="Human CMV immediate early promoter, forward primer"
misc_feature 1035..1160
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1657..1890
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2075..2119
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2268..2309
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 2413..2530
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
primer_bind complement(2629..2645)
/label=KS primer
/note="common sequencing primer, one of multiple similar
variants"
promoter 2645..2959
/label=tight TRE promoter
/note="Tet-responsive promoter PTight, consisting of seven
tet operator sequences followed by the minimal CMV
promoter"
CDS 3073..3102
/label=Myc
/note="Myc (human c-Myc proto-oncogene) epitope tag"
CDS 3109..3909
/gene="xthA"
/label=xthA
/note="Exodeoxyribonuclease III from Escherichia coli
(strain K12). Accession#: P09030"
primer_bind 3921..3937
/label=SK primer
/note="common sequencing primer, one of multiple similar
variants"
promoter 3991..4320
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
CDS 4334..4930
/label=PuroR
/note="puromycin N-acetyltransferase"
LTR 5551..5731
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(5793..6381)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6555..7412)
/label=AmpR
/note="beta-lactamase"
promoter complement(7413..7517)
/label=AmpR promoter
This page is informational only.