LeGO-iC2 vector (Cat. No.: V010515)

LeGO-iC27820 bp30060090012001500180021002400270030003300360039004200450048005100540057006000630066006900720075007800CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSKS primerloxPSFFV promoterIRES2mCherryloxPWPREKS primer5' LTR (truncated)oriAmpRAmpR promoter
Basic Information

Note: Cloning host is Stbl3 or TOP10

Name:
LeGO-iC2
Antibiotic Resistance:
Ampicillin
Length:
7820 bp
Type:
Lentiviral vectors
Replication origin:
ori
Copy Number:
High copy number
Promoter:
SFFV
Cloning Method:
Enzyme digestion and ligation
5' Primer:
GAGCTCACAACCCCTCACTC
$ 199.0
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

LeGO-iC2 vector (Cat. No.: V010515) Sequence

LOCUS       V010515                 7820 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V010515
VERSION     V010515
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7820)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 7820)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7820
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        238..617
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        618..820
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             835..1015
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1062..1187
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1686..1919
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2104..2148
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2297..2338
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2446..2563
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     primer_bind     2622..2638
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    2680..2713
                     /label="Cre recombinase binding site"
                     /bound_moiety="Cre recombinase"
                     /note="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (GCATACAT)."
     promoter        2784..3190
                     /label="SFFV promoter"
                     /note="spleen focus-forming virus long terminal repeat
                     (LTR) promoter"
     misc_feature    3276..3862
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             3863..4570
                     /label="mCherry"
                     /note="monomeric derivative of DsRed fluorescent protein
                     (Shaner et al., 2004)"
     protein_bind    complement(4620..4653)
                     /label="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     misc_feature    4709..5297
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(5300..5316)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             5826..6006
                     /label="5' LTR (truncated)"
                     /note="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(6068..6656)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6830..7687)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7688..7792)
                     /label="AmpR promoter"