Basic Vector Information
Cloning host is Stbl3 or TOP10
- Vector Name:
- LeGO-iC2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7820 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- High copy number
- Promoter:
- SFFV
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- GAGCTCACAACCCCTCACTC
LeGO-iC2 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
LeGO-iC2 vector Sequence
LOCUS 40924_1619 7820 bp DNA circular SYN 13-JAN-2022
DEFINITION synthetic circular DNA.
ACCESSION .
VERSION .
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 7820)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 7820)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7820
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 238..617
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 618..820
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 835..1015
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1062..1187
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1686..1919
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2104..2148
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2297..2338
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 2446..2563
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
primer_bind 2622..2638
/label=KS primer
/note="common sequencing primer, one of multiple similar
variants"
protein_bind 2680..2713
/label=Cre recombinase binding site
/bound_moiety="Cre recombinase"
/note="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (GCATACAT)."
promoter 2784..3190
/label=SFFV promoter
/note="spleen focus-forming virus long terminal repeat
(LTR) promoter"
misc_feature 3276..3862
/label=IRES2
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 3863..4570
/label=mCherry
/note="monomeric derivative of DsRed fluorescent protein
(Shaner et al., 2004)"
protein_bind complement(4620..4653)
/label=loxP
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
misc_feature 4709..5297
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(5300..5316)
/label=KS primer
/note="common sequencing primer, one of multiple similar
variants"
LTR 5826..6006
/label=5' LTR (truncated)
/note="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(6068..6656)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6830..7687)
/label=AmpR
/note="beta-lactamase"
promoter complement(7688..7792)
/label=AmpR promoter
This page is informational only.