Basic Vector Information
- Vector Name:
- pQE-30-HyPer3
- Antibiotic Resistance:
- Ampicillin
- Length:
- 4859 bp
- Type:
- Bacterial Expression
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- T5
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- aggagaaattaactatgagagg
- 3' Primer:
- ccagatggagttctgaggtc
pQE-30-HyPer3 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pQE-30-HyPer3 vector Sequence
LOCUS pQE-30-HyPer3. 4859 bp DNA circular SYN 13-MAY-2021 DEFINITION Genetically encoded H2O2 probe for ratiometric and fluorescence lifetime imaging. ACCESSION . VERSION . KEYWORDS pQE-30-HyPer3. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 4859) AUTHORS Bilan DS, Pase L, Joosen L, Gorokhovatsky AY, Ermakova YG, Gadella TW, Grabher C, Schultz C, Lukyanov S, Belousov VV TITLE HyPer-3: a genetically encoded H2O2 probe with improved performance for ratiometric and fluorescence lifetime imaging. JOURNAL ACS Chem Biol. 2012 Dec 20. PUBMED 23256573 REFERENCE 2 (bases 1 to 4859) TITLE Direct Submission REFERENCE 3 (bases 1 to 4859) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "ACS Chem Biol. 2012 Dec 20." COMMENT SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..4859 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 10..54 /label=T5 promoter /note="bacteriophage T5 promoter for E. coli RNA polymerase, with embedded lac operator" protein_bind 62..78 /label=lac operator /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." RBS 97..108 /note="strong bacterial ribosome binding site (Elowitz and Leibler, 2000)" CDS 127..144 /label=6xHis /note="6xHis affinity tag" CDS 151..1581 /label=HyPer-3 /note="improved fluorescent indicator for intracellular H2O2 (Bilan et al., 2013)" terminator 1606..1700 /label=lambda t0 terminator /note="transcription terminator from phage lambda" CDS 1744..2400 /label=CmR /note="chloramphenicol acetyltransferase" terminator 2468..2554 /label=rrnB T1 terminator /note="transcription terminator T1 from the E. coli rrnB gene" primer_bind complement(2601..2623) /label=pGEX 3' /note="pGEX vectors, reverse primer" misc_feature 2709..2849 /label=bom /note="basis of mobility region from pBR322" primer_bind complement(2864..2881) /label=L4440 /note="L4440 vector, forward primer" rep_origin complement(3035..3623) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(3797..4654) /label=AmpR /note="beta-lactamase" promoter complement(4655..4759) /label=AmpR promoter primer_bind 4827..4845 /label=pBRforEco /note="pBR322 vectors, upsteam of EcoRI site, forward primer"
This page is informational only.