pcDNA3/Flag-METTL3 vector (V010070)

Basic Vector Information

      • Vector Name:
      • pcDNA3/Flag-METTL3
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 7052 bp
      • Type:
      • Mammalian Expression
      • Replication origin:
      • ori
      • Promoter:
      • SP6
      • Cloning Method:
      • Restriction Enzyme
      • 5' Primer:
      • 5' TAATACGACTCACTATAGGG 3'
      • 3' Primer:
      • 5' ATTTAGGTGACACTATAG 3'

pcDNA3/Flag-METTL3 vector Vector Map

pcDNA3/Flag-METTL37052 bp30060090012001500180021002400270030003300360039004200450048005100540057006000630066006900F1ori-FpBABE 3'SV40 promoterNeoR/KanRSV40 poly(A) signalM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-markerCMV enhancerCMV promoterT7 promoterFLAGMETTL3SP6 promoterbGH poly(A) signalf1 ori

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

pcDNA3/Flag-METTL3 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       pcDNA3/Flag-METT        7052 bp DNA     circular SYN 21-DEC-2021
DEFINITION  For expression of METTL3 (methyltransferase-like 3) in human cells.
ACCESSION   .
VERSION     .
KEYWORDS    pcDNA3/Flag-METTL3.
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 7052)
  AUTHORS   Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng 
            X, Dai Q, Chen W, He C
  TITLE     A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine
            methylation.
  JOURNAL   Nat Chem Biol. 2014 Feb;10(2):93-5. doi: 10.1038/nchembio.1432. Epub
            2013 Dec 6.
  PUBMED    24316715
REFERENCE   2  (bases 1 to 7052)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7052)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1038/nchembio.1432"; journalName: "Nat Chem Biol"; date: 
            "2014-02"; volume: "10"; issue: "2"; pages: "93-5"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7052
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     primer_bind     23..44
                     /label=F1ori-F
                     /note="F1 origin, forward primer"
     primer_bind     complement(163..183)
                     /label=pBABE 3'
                     /note="SV40 enhancer, reverse primer for pBABE vectors"
     promoter        207..417
                     /label=SV40 promoter
                     /note="SV40 early promoter"
     CDS             492..1283
                     /label=NeoR/KanR
                     /note="aminoglycoside phosphotransferase"
     polyA_signal    1460..1593
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(1630..1646)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
                     variants"
     protein_bind    complement(1654..1670)
                     /label=lac operator
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1678..1708)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(1723..1744)
                     /label=CAP binding site
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(1861..1878)
                     /label=L4440
                     /note="L4440 vector, forward primer"
     rep_origin      complement(2032..2620)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(2794..3651)
                     /label=AmpR
                     /note="beta-lactamase"
     promoter        complement(3652..3756)
                     /label=AmpR promoter
     primer_bind     complement(3831..3850)
                     /label=pRS-marker
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     enhancer        4022..4401
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        4402..4605
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     promoter        4650..4668
                     /label=T7 promoter
                     /note="promoter for bacteriophage T7 RNA polymerase"
     CDS             4685..4708
                     /label=FLAG
                     /note="FLAG(R) epitope tag, followed by an enterokinase
                     cleavage site"
     CDS             4709..6445
                     /gene="METTL3"
                     /label=METTL3
                     /note="N6-adenosine-methyltransferase catalytic subunit
                     from Homo sapiens. Accession#: Q86U44"
     promoter        complement(6464..6482)
                     /label=SP6 promoter
                     /note="promoter for bacteriophage SP6 RNA polymerase"
     polyA_signal    6508..6732
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      6778..7052
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"

This page is informational only.