Basic Vector Information
- Vector Name:
- LZRS ERTm RasV12
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12382 bp
- Type:
- Retroviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- Low Copy
- Promoter:
- mPGK
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- TGGATACACGCCGCCCACGTG
- 3' Primer:
- ATCGTCGACCACTGTGCTGG
LZRS ERTm RasV12 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
LZRS ERTm RasV12 vector Sequence
LOCUS LZRS_ERTm_RasV12 12382 bp DNA circular SYN 13-MAY-2021
DEFINITION synthetic circular DNA.
ACCESSION .
VERSION .
KEYWORDS LZRS ERTm RasV12.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 12382)
AUTHORS Dajee M, Tarutani M, Deng H, Cai T, Khavari PA
TITLE Epidermal Ras blockade demonstrates spatially localized Ras
promotion of proliferation and inhibition of differentiation
JOURNAL Oncogene. 2002 Feb 28;21(10):1527-38
PUBMED 11896581
REFERENCE 2 (bases 1 to 12382)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12382)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Oncogene.";
date: "2002-02-28"; volume: "21(10)"; pages: "1527-3"
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12382
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 445..807
/gene="ESR1"
/label=ESR1
/note="Estrogen receptor from Macaca mulatta. Accession#:
P49886"
CDS 1045..1611
/label=H-Ras (G12V)
/note="human oncoprotein generated by the G12V mutation in
the small GTPase H-Ras"
LTR 1713..2304
/label=LTR
/note="long terminal repeat from Moloney murine leukemia
virus"
primer_bind complement(2434..2451)
/label=L4440
/note="L4440 vector, forward primer"
rep_origin complement(2605..3193)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
polyA_signal complement(3316..3450)
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
CDS complement(3683..4279)
/label=PuroR
/note="puromycin N-acetyltransferase"
promoter complement(4362..4861)
/label=PGK promoter
/note="mouse phosphoglycerate kinase 1 promoter"
rep_origin 6893..8682
/label=oriP
/note="Epstein-Barr virus oriP replication origin (Yates et
al., 2000)"
CDS complement(9179..10036)
/label=AmpR
/note="beta-lactamase"
promoter complement(10037..10141)
/label=AmpR promoter
LTR 10557..11149
/label=LTR
/note="long terminal repeat from Moloney murine leukemia
virus"
misc_feature 11212..11569
/label=MMLV Psi
/note="packaging signal of Moloney murine leukemia virus
(MMLV)"
CDS 11634..12050
/label=gag (truncated)
/note="truncated Moloney murine leukemia virus (MMLV) gag
gene lacking the start codon"
This page is informational only.