Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012812 | pAAV-Ef1a-fDIO EYFP | In stock (lyophilized plasmid) |
Buy one, get one free! |
Two vials of lyophilized plasmid will be delivered, each vial is about 5µg.
Basic Vector Information
EF1a-driven, Flp-dependent expression of EYFP.
- Vector Name:
- pAAV-Ef1a-fDIO EYFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 6313 bp
- Type:
- Mammalian Expression Vectors
- Replication origin:
- ori
- Source/Author:
- Karl Deisseroth
- Copy Number:
- High copy number
- Promoter:
- EF-1α
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- CACCCACACAAAGGAAAAGGGCC
- 3' Primer:
- GCAATAGCATGATACAAAGG
pAAV-Ef1a-fDIO EYFP vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pAAV-Ef1a-fDIO EYFP vector Sequence
LOCUS pAAV-Ef1a-fDIO_E 6313 bp DNA circular SYN 12-MAY-2021 DEFINITION Flp-Dependent EYFP. ACCESSION . VERSION . KEYWORDS pAAV-Ef1a-fDIO EYFP. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 6313) AUTHORS Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K TITLE Targeting cells with single vectors using multiple-feature Boolean logic. JOURNAL Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. PUBMED 24908100 REFERENCE 2 (bases 1 to 6313) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1038/nmeth.2996"; journalName: "Nat Methods"; date: "2014-07"; volume: "11"; issue: "7"; pages: "763-72" FEATURES Location/Qualifiers source 1..6313 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 1..1179 /label=EF-1-alpha promoter /note="strong constitutive promoter for human elongation factor EF-1-alpha" protein_bind 1210..1243 /label=FRT (minimal) /note="supports FLP-mediated excision but not integration (Turan and Bode, 2011)" CDS complement(1339..2055) /label=EYFP /note="enhanced YFP" protein_bind complement(2068..2101) /label=FRT (minimal) /note="supports FLP-mediated excision but not integration (Turan and Bode, 2011)" misc_feature 2210..2798 /label=WPRE /note="woodchuck hepatitis virus posttranscriptional regulatory element" polyA_signal 2830..3306 /label=hGH poly(A) signal /note="human growth hormone polyadenylation signal" repeat_region 3346..3486 /label=AAV2 ITR /note="inverted terminal repeat of adeno-associated virus serotype 2" rep_origin 3561..4016 /label=f1 ori /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 4298..4402 /label=AmpR promoter CDS 4403..5260 /label=AmpR /note="beta-lactamase" rep_origin 5434..6022 /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" repeat_region 6084..6213 /label=AAV2 ITR (alternate) /note="AAV2 ITR (alternate)" /note="Functional equivalent of wild-type AAV2 ITR" promoter 6313 /label=EF-1-alpha promoter /note="strong constitutive promoter for human elongation factor EF-1-alpha"