pLKO.1-TRC vector (Cat. No.: V012791)
Note: This is the recommended vector for cloning and expressing new shRNA sequences. This plasmid is being used by The RNAi Consortium to produce their shRNA library http://www.broad.mit.edu/genome_bio/trc/ The 1.9kb stuffer can be released with AgeI and EcoRI and replaced with your shRNA sequence of choice.
- Name:
- pLKO.1-TRC
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8901 bp
- Type:
- RNAi
- Replication origin:
- ori
- Source/Author:
- David Root
- Copy Number:
- High copy number
- Promoter:
- hPGK
- Cloning Method:
- Enzyme Cut
- 5' Primer:
- LKO.15' :GACTATCATATGCTTACCGT
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
- Expression Method:
- Constiutive, Stable / Transient
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Kanungo J. Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells. Biochem Biophys Res Commun. 2017 Apr 29;486(2):481-485. doi: 10.1016/j.bbrc.2017.03.066. Epub 2017 Mar 16. PMID: 28322785; PMCID: PMC5462107.
pLKO.1-TRC vector (Cat. No.: V012791) Sequence
LOCUS V012791 8901 bp DNA circular SYN 13-DEC-2021
DEFINITION Exported.
ACCESSION V012791
VERSION V012791
KEYWORDS pLKO.1-TRC
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 8901)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 8901)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..8901
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 7..507
/label="hPGK promoter"
/note="human phosphoglycerate kinase 1 promoter"
CDS 529..1125
/label="PuroR"
/note="puromycin N-acetyltransferase"
LTR 1256..1489
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 1561..1695
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 1722..1857
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(1878..1896)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(1906..1922)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 2064..2519
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 2545..2649
/label="AmpR promoter"
CDS 2650..3507
/label="AmpR"
/note="beta-lactamase"
rep_origin 3681..4269
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
protein_bind 4557..4578
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 4593..4623
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 4631..4647
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 4655..4671
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
promoter 4692..4710
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
promoter 4738..4964
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 4965..5145
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 5192..5317
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 5810..6043
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 6228..6272
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 6421..6462
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
promoter 6570..6810
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_feature 6822..8690
/label="stuffer"
/note="stuffer"
misc_feature 8732..8849
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 8898..8901
/label="hPGK promoter"
/note="human phosphoglycerate kinase 1 promoter"