pLKO.1-TRC vector (V012791) Gene synthesis in pLKO.1-TRC backbone

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V012791 pLKO.1-TRC In stock, instant shipping

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

This is the recommended vector for cloning and expressing new shRNA sequences. This plasmid is being used by The RNAi Consortium to produce their shRNA library http://www.broad.mit.edu/genome_bio/trc/ The 1.9kb stuffer can be released with AgeI and EcoRI and replaced with your shRNA sequence of choice.

Vector Name:
pLKO.1-TRC
Antibiotic Resistance:
Ampicillin
Length:
8901 bp
Type:
RNAi
Replication origin:
ori
Source/Author:
David Root
Copy Number:
High copy number
Promoter:
hPGK
Cloning Method:
Enzyme Cut
5' Primer:
LKO.15' :GACTATCATATGCTTACCGT
Growth Strain(s):
stbl3
Growth Temperature:
37℃
Expression Method:
Constiutive, Stable / Transient

pLKO.1-TRC vector Map

pLKO.1-TRC8901 bp40080012001600200024002800320036004000440048005200560060006400680072007600800084008800hPGK promoterPuroR3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterM13 fwdf1 oriAmpR promoterAmpRoriCAP binding sitelac promoterlac operatorM13 revT3 promoterRSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatU6 promoterstuffercPPT/CTShPGK promoter

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLKO.1-TRC vector Sequence

LOCUS       V012791                 8901 bp    DNA     circular SYN 13-DEC-2021
DEFINITION  Exported.
ACCESSION   V012791
VERSION     V012791
KEYWORDS    pLKO.1-TRC
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8901)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 8901)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8901
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        7..507
                     /label="hPGK promoter"
                     /note="human phosphoglycerate kinase 1 promoter"
     CDS             529..1125
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     LTR             1256..1489
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    1561..1695
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      1722..1857
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(1878..1896)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(1906..1922)
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     rep_origin      2064..2519
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        2545..2649
                     /label="AmpR promoter"
     CDS             2650..3507
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      3681..4269
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     protein_bind    4557..4578
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4593..4623
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4631..4647
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4655..4671
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        4692..4710
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"
     promoter        4738..4964
                     /label="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             4965..5145
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    5192..5317
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    5810..6043
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             6228..6272
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             6421..6462
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     promoter        6570..6810
                     /label="U6 promoter"
                     /note="RNA polymerase III promoter for human U6 snRNA"
     misc_feature    6822..8690
                     /label="stuffer"
                     /note="stuffer"
     misc_feature    8732..8849
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        8898..8901
                     /label="hPGK promoter"
                     /note="human phosphoglycerate kinase 1 promoter"