pWPXL vector (Cat. No.: V012765)

pWPXL10538 bp50010001500200025003000350040004500500055006000650070007500800085009000950010000105003' LTRHIV-1 PsiRREgp41 peptideProtein TatEF-1-alpha promotercPPT/CTSEGFPWPREloxP5' LTR (truncated)SP6 promoterAmpR promoterAmpRoriSV40 promotersmall t intronSV40 NLSSV40 poly(A) signal
Basic Information

Note: 2nd generation lentiviral transfer plasmid

Name:
pWPXL
Antibiotic Resistance:
Ampicillin
Length:
10538 bp
Type:
Viral Expression & Packaging Vectors
Replication origin:
ori
Source/Author:
Didier Trono
Selection Marker:
EGFP
Copy Number:
High copy number
Promoter:
EF1A
Cloning Method:
Enzyme Cut
5' Primer:
EF-1a Forward: TCAAGCCTCAGACAGTGGTTC
3' Primer:
EGFP-N: CGTCGCCGTCCAGCTCGACCAG
Fusion Tag:
EGFP
Growth Strain(s):
stbl3
Growth Temperature:
37℃
Expression Method:
Constiutive, Stable / Transient
$ 199.0
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pWPXL vector (Cat. No.: V012765) Sequence

LOCUS       pWPXL       10538 bp DNA     circular SYN 20-JUL-2025
DEFINITION  Exported.
ACCESSION   V012765
VERSION     .
KEYWORDS    pWPXL
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 10538)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 10538)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 10538)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10538
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     source          2025..2049
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     LTR             2..635
                     /label=3' LTR
                     /note="3' long terminal repeat (LTR) from HIV-1"
     misc_feature    682..807
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1300..1533
                     /label=RRE
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
                     cytoplasm."
     CDS             1718..1762
                     /label=gp41 peptide
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et 
                     al., 2013)"
     CDS             1911..1952
                     /label=Protein Tat
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
     promoter        2145..3323
                     /label=EF-1-alpha promoter
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     misc_feature    3371..3487
                     /label=cPPT/CTS
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     CDS             3571..4287
                     /label=EGFP
                     /note="enhanced GFP"
     misc_feature    4369..4957
                     /label=WPRE
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     protein_bind    complement(5101..5134)
                     /label=loxP
                     /note="Cre-mediated recombination occurs in the 8-bp core 
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     LTR             5154..5334
                     /label=5' LTR (truncated)
                     /note="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     promoter        complement(5359..5377)
                     /label=SP6 promoter
                     /note="promoter for bacteriophage SP6 RNA polymerase"
     promoter        6165..6269
                     /label=AmpR promoter
     CDS             6270..7127
                     /label=AmpR
                     /note="beta-lactamase"
     rep_origin      7301..7889
                     /direction=RIGHT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     promoter        8135..8464
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     intron          9598..9663
                     /label=small t intron
                     /note="SV40 (simian virus 40) small t antigen intron"
     CDS             9793..9813
                     /label=SV40 NLS
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     polyA_signal    10238..10372
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"