pLVX-EF1α-IRES-mCherry vector (V012682) Gene synthesis in pLVX-EF1α-IRES-mCherry backbone

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V012682 pLVX-EF1α-IRES-mCherry In stock, instant shipping

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

pLVX-EF1α-IRES-mCherry is a lentiviral bicistronic expression vector for constitutively co-expressing a protein of interest. It includes a mCherry from the EF-1α promoter.

Vector Name:
pLVX-EF1α-IRES-mCherry
Antibiotic Resistance:
Ampicillin
Length:
8904 bp
Type:
Viral Expression & Packaging Vectors
Replication origin:
ori
Source/Author:
Clontech
Selection Marker:
mCherry
Copy Number:
High copy number
Promoter:
EF-1α
Cloning Method:
Enzyme Cut
5' Primer:
EF1a Forward: TCAAGCCTCAGACAGTGGTTC
3' Primer:
IRES-R: CCTCACATTGCCAAAAGACG
Growth Strain(s):
stbl3
Growth Temperature:
37℃
Expression Method:
Constiutive, Stable

pLVX-EF1α-IRES-mCherry vector Map

pLVX-EF1α-IRES-mCherry8904 bp400800120016002000240028003200360040004400480052005600600064006800720076008000840088003' LTRHIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSEF-1-alpha promotermCherryWPRE5' LTRM13 revlac operatorlac promoterCAP binding siteoriAmpRAmpR promoterSV40 poly(A) signal

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Shi Y, Yuan J, Rraklli V, Maxymovitz E, Cipullo M, Liu M, Li S, Westerlund I, Bedoya-Reina OC, Bullova P, Rorbach J, Juhlin CC, Stenman A, Larsson C, Kogner P, O'Sullivan MJ, Schlisio S, Holmberg J. Aberrant splicing in neuroblastoma generates RNA-fusion transcripts and provides vulnerability to spliceosome inhibitors. Nucleic Acids Res. 2021 Mar 18;49(5):2509-2521.

pLVX-EF1α-IRES-mCherry vector Sequence

LOCUS       V012682                 8904 bp    DNA     circular SYN 25-NOV-2020
DEFINITION  Exported.
ACCESSION   V012682
VERSION     V012682
KEYWORDS    pLVX-EF1-alpha-IRES-mCherry
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8904)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 8904)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8904
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     LTR             1..634
                     /label="3' LTR"
                     /note="3' long terminal repeat (LTR) from HIV-1"
     misc_feature    681..806
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1303..1536
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1721..1765
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             1914..1955
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2027..2144
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2338..3519
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     misc_feature    3575..4152
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             4149..4856
                     /label="mCherry"
                     /note="monomeric derivative of DsRed fluorescent protein
                     (Shaner et al., 2004)"
     misc_feature    4873..5461
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             5668..6301
                     /label="5' LTR"
                     /note="5' long terminal repeat (LTR) from HIV-1"
     primer_bind     complement(6429..6445)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    complement(6453..6469)
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(6477..6507)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(6522..6543)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(6831..7419)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(7593..8450)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(8451..8555)
                     /label="AmpR promoter"
     polyA_signal    8603..8737
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"