lentiCRISPRv2 hygro vector (Cat. No.: V000398)
Note: LentiCRISPRv2 hygro is a lentiviral vector for mammalian CRISPR-Cas9 gene editing. It expresses Cas9 and a single-guide RNA, and uses hygromycin resistance for selection, enabling stable knockout of target genes following lentiviral transduction.
- Name:
- lentiCRISPRv2 hygro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 15261 bp
- Type:
- Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Hygromycin
- Copy Number:
- High Copy
- Promoter:
- SV40
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- CCAAAGAGGTGCTGGACG
- 3' Primer:
- WPRE-R (CATAGCGTAAAAGGAGCAACA)
- Growth Strain(s):
- Stbl3
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoué K, Offenhäuser C, Akgül S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. Erratum in: Sci Rep. 2020 Jan 21;10(1):1185. doi: 10.1038/s41598-020-57850-w. PMID: 30894629; PMCID: PMC6427001.
lentiCRISPRv2 hygro vector (Cat. No.: V000398) Sequence
LOCUS V000398 15261 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000398
VERSION V000398
KEYWORDS lentiCRISPRv2 hygro
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 15261)
AUTHORS Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC,
Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T,
Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis
PL, Jeffree RL, Johns TG, Boyd AW
TITLE A reference collection of patient-derived cell line and xenograft
models of proneural, classical and mesenchymal glioblastoma.
JOURNAL Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z.
PUBMED 30894629
REFERENCE 2 (bases 1 to 15261)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 15261)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Sci Rep.";
date: "2019-03-20"; pages: "
10.1038/s41598-019-41277-z"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..15261
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind complement(47..66)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 242..621
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 622..824
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 839..1019
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1066..1191
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1684..1917
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2102..2146
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2295..2336
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2444..2561
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2612..2852
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 4742..4817
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
promoter 4879..5090
/label="EF-1-alpha core promoter"
/note="core promoter for human elongation factor
EF-1-alpha"
CDS 5115..9218
/label="Cas9"
/note="Cas9 (Csn1) endonuclease from the Streptococcus
pyogenes Type II CRISPR/Cas system"
CDS 9219..9266
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label="nucleoplasmin NLS"
/translation="KRPAATKKAGQAKKKK"
CDS 9267..9290
/label="FLAG"
/note="FLAG(R) epitope tag, followed by an enterokinase
cleavage site"
CDS 9300..9356
/label="P2A"
/note="2A peptide from porcine teschovirus-1 polyprotein"
CDS 9357..10328
/label="HygR"
/note="aminoglycoside phosphotransferase from E. coli"
misc_feature 10353..10941
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 11013..11246
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 11278..11502
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 11548..11976
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 11990..12319
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 12367..12414
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 12433..12804
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 12937..13070
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(13107..13123)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(13107..13123)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(13120..13142)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 13131..13147
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(13155..13185)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(13200..13221)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(13338..13355)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(13509..14097)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(14271..15128)
/label="AmpR"
/note="beta-lactamase"
promoter complement(15129..15233)
/label="AmpR promoter"