Basic Vector Information
- Vector Name:
- pLV-dCas9-p300-P2A-PuroR
- Antibiotic Resistance:
- Ampicillin
- Length:
- 14538 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Promoter:
- EM7
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- ATCCGGTGCCTAGAGAAGGT
pLV-dCas9-p300-P2A-PuroR vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pLV-dCas9-p300-P2A-PuroR vector Sequence
LOCUS V000455 14538 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000455
VERSION V000455
KEYWORDS pLV-dCas9-p300-P2A-PuroR.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 14538)
AUTHORS Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB,
Crawford GE, Reddy TE, Gersbach CA
TITLE CRISPR-Cas9 epigenome editing enables high-throughput screening for
functional regulatory elements in the human genome.
JOURNAL Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853.
PUBMED 28369033
REFERENCE 2 (bases 1 to 14538)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 14538)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..14538
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 1..380
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 381..583
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 598..778
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 825..950
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1443..1676
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1861..1905
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2054..2095
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2203..2320
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2440..2651
/label="EF-1-alpha core promoter"
/note="core promoter for human elongation factor
EF-1-alpha"
CDS 2676..6779
/label="dCas9"
/note="catalytically dead mutant of the Cas9 endonuclease
from the Streptococcus pyogenes Type II CRISPR/Cas system"
CDS 6780..6827
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label="nucleoplasmin NLS"
/translation="KRPAATKKAGQAKKKK"
CDS 6834..8684
/label="p300 core"
/note="catalytic histone acetyltransferase core of the
human E1A-associated protein p300 (Delvecchio et al.,
2013)"
CDS 8691..8714
/label="FLAG"
/note="FLAG(R) epitope tag, followed by an enterokinase
cleavage site"
CDS 8724..8780
/label="P2A"
/note="2A peptide from porcine teschovirus-1 polyprotein"
CDS 8781..9374
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature 9393..9981
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 10053..10286
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 10318..10542
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 10588..11016
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 11030..11359
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 11407..11454
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 11473..11844
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 11977..12110
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(12147..12163)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(12147..12163)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(12160..12182)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 12171..12187
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(12195..12225)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(12240..12261)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(12378..12395)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(12549..13137)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(13311..14168)
/label="AmpR"
/note="beta-lactamase"
promoter complement(14169..14273)
/label="AmpR promoter"
primer_bind complement(14348..14367)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
This page is informational only.