lenti-EF1a-dCas9-KRAB-Puro vector (V000709)

Basic Vector Information

      • Vector Name:
      • lenti-EF1a-dCas9-KRAB-Puro
      • Antibiotic Resistance:
      • Ampicillin
      • Length:
      • 14337 bp
      • Type:
      • Mammalian Expression, Lentiviral, CRISPR
      • Selection Marker:
      • Puromycin, Zeocin
      • Copy Number:
      • High Copy
      • Promoter:
      • EF-1a
      • Cloning Method:
      • Gibson Cloning
      • 5' Primer:
      • 3' Primer:
      • cacatagcgtaaaaggagcaacatag

lenti-EF1a-dCas9-KRAB-Puro vector Vector Map

lenti-EF1a-dCas9-KRAB-Puro14337 bp7001400210028003500420049005600630070007700840091009800105001120011900126001330014000RREgp41 peptidecPPT/CTSEF-1-alpha promoternucleoplasmin NLSdCas9SV40 NLSKRABT2APuroRWPREKS primer5' LTR (truncated)BGH-revf1 oripBABE 3'EM7 promoterBleoRSV40 poly(A) signalM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-markerCMV enhancerCMV promoter5' LTR (truncated)HIV-1 Psi

Plasmid Resuspension Protocol:

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5.Store the plasmid at -20 ℃.

lenti-EF1a-dCas9-KRAB-Puro vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       Exported               14337 bp ds-DNA     circular SYN 13-MAY-2021
DEFINITION  3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin 
            resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE).
KEYWORDS    lenti-EF1a-dCas9-KRAB-Puro
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 14337)
  AUTHORS   Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, 
            Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ
  TITLE     Evaluating Synthetic Activation and Repression of 
            Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and 
  JOURNAL   Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 
            10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27.
  PUBMED    28757163
REFERENCE   2  (bases 1 to 14337)
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: 
            "10.1016/j.stemcr.2017.06.012"; journalName: "Stem Cell Reports"; 
            date: "2017-08-8- 8"; volume: "9"; issue: "2"; pages: "615-628"
FEATURES             Location/Qualifiers
     source          1..14337
                     /organism="synthetic DNA construct"
                     /mol_type="other DNA"
     misc_feature    179..412
                     /note="The Rev response element (RRE) of HIV-1 allows for 
                     Rev-dependent mRNA export from the nucleus to the 
     CDS             597..641
                     /product="antigenic peptide corresponding to amino acids 
                     655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik 
                     et al., 2013)"
                     /label=gp41 peptide
                     /note="recognized by the 2H10 single-chain llama nanobody"
     misc_feature    939..1056
                     /note="central polypurine tract and central termination 
                     sequence of HIV-1"
     promoter        1186..2364
                     /label=EF-1-alpha promoter
                     /note="strong constitutive promoter for human elongation 
                     factor EF-1-alpha"
     intron          1417..2355
                     /label=EF-1-alpha intron A
                     /note="intron upstream of the start codon of human 
     primer_bind     2312..2332
                     /note="Human elongation factor-1a promoter, forward primer"
     CDS             2380..2427
                     /product="bipartite nuclear localization signal from 
                     /label=nucleoplasmin NLS
     CDS             2428..6528
                     /product="catalytically dead mutant of the Cas9 
                     endonuclease from the Streptococcus pyogenes Type II 
                     CRISPR/Cas system"
                     /note="RNA-guided DNA-binding protein that lacks 
                     endonuclease activity due to the D10A mutation in the RuvC 
                     catalytic domain and the N863A mutation in the HNH 
                     catalytic domain"
     CDS             6583..6603
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label=SV40 NLS
     CDS             6628..6822
                     /product="Kruppel-associated box (KRAB) transcriptional 
                     repression domain from the human zinc finger protein ZNF10 
                     (Margolin et al., 1994)"
     CDS             6844..6897
                     /product="2A peptide from Thosea asigna virus capsid 
                     /note="Eukaryotic ribosomes fail to insert a peptide bond 
                     between the Gly and Pro residues, yielding separate 
     CDS             6910..7503
                     /gene="pac from Streptomyces alboniger"
                     /product="puromycin N-acetyltransferase"
                     /note="confers resistance to puromycin"
     primer_bind     7400..7420
                     /note="Puromycin resistance gene, forward primer"
     misc_feature    7528..8116
                     /note="woodchuck hepatitis virus posttranscriptional 
                     regulatory element"
     primer_bind     complement(7581..7601)
                     /note="WPRE, reverse primer"
     CDS             complement(7999..8010)
                     /product="Factor Xa recognition and cleavage site"
                     /label=Factor Xa site
     primer_bind     complement(8119..8135)
                     /label=KS primer
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(8120..8136)
                     /note="For pBluescript vector"
     LTR             8641..8821
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     primer_bind     complement(8847..8864)
                     /note="Bovine growth hormone terminator, reverse primer. 
                     Also called BGH reverse"
     polyA_signal    8853..9077
                     /label=bGH poly(A) signal
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      9123..9551
                     /label=f1 ori
                     /note="f1 bacteriophage origin of replication; arrow 
                     indicates direction of (+) strand synthesis"
     primer_bind     complement(9210..9229)
                     /note="F1 origin, reverse primer"
     primer_bind     9420..9441
                     /note="F1 origin, forward primer"
     primer_bind     complement(9560..9580)
                     /label=pBABE 3'
                     /note="SV40 enhancer, reverse primer for pBABE vectors"
     promoter        9565..9894
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     rep_origin      9745..9880
                     /label=SV40 ori
                     /note="SV40 origin of replication"
     primer_bind     9807..9826
                     /note="SV40 promoter/origin, forward primer"
     promoter        9942..9989
                     /label=EM7 promoter
                     /note="synthetic bacterial promoter "
     CDS             10008..10382
                     /gene="Sh ble from Streptoalloteichus hindustanus"
                     /product="antibiotic-binding protein"
                     /note="confers resistance to bleomycin, phleomycin, and 
     polyA_signal    10512..10633
                     /label=SV40 poly(A) signal
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(10549..10568)
                     /note="SV40 polyA, reverse primer"
     primer_bind     10603..10622
                     /note="SV40 polyA terminator, reverse primer"
     primer_bind     complement(10682..10698)
                     /label=M13 rev
                     /note="common sequencing primer, one of multiple similar 
     primer_bind     complement(10682..10698)
                     /label=M13 Reverse
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(10695..10717)
                     /label=M13/pUC Reverse
                     /note="In lacZ gene"
     protein_bind    10706..10722
                     /label=lac operator
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to 
                     inhibit transcription in E. coli. This inhibition can be 
                     relieved by adding lactose or 
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(10730..10760)
                     /label=lac promoter
                     /note="promoter for the E. coli lac operon"
     protein_bind    10775..10796
                     /label=CAP binding site
                     /bound_moiety="E. coli catabolite activator protein"
                     /note="CAP binding activates transcription in the presence 
                     of cAMP."
     primer_bind     complement(10913..10930)
                     /note="L4440 vector, forward primer"
     rep_origin      complement(11084..11672)
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
     primer_bind     complement(11164..11183)
                     /note="pBR322 origin, forward primer"
     CDS             complement(11843..12703)
                     /note="confers resistance to ampicillin, carbenicillin, and
                     related antibiotics"
     primer_bind     12466..12485
                     /note="Ampicillin resistance gene, reverse primer"
     promoter        complement(12704..12808)
                     /label=AmpR promoter
     primer_bind     complement(12883..12902)
                     /note="pRS vectors, use to sequence yeast selectable 
     enhancer        13074..13453
                     /label=CMV enhancer
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        13455..13653
                     /label=CMV promoter
                     /note="human cytomegalovirus (CMV) immediate early 
     primer_bind     13608..13628
                     /note="Human CMV immediate early promoter, forward primer"
     LTR             13671..13851
                     /label=5' LTR (truncated)
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    13898..14023
                     /label=HIV-1 Psi
                     /note="packaging signal of human immunodeficiency virus 
                     type 1"

This page is informational only.