lenti-EF1a-dCas9-KRAB-Puro vector (Cat. No.: V000709)

lenti-EF1a-dCas9-KRAB-Puro14337 bp7001400210028003500420049005600630070007700840091009800105001120011900126001330014000RREgp41 peptideProtein TatcPPT/CTSEF-1-alpha promoternucleoplasmin NLSdCas9SV40 NLSKRABT2APuroRWPREKS primer5' LTR (truncated)bGH poly(A) signalf1 oriSV40 promoterEM7 promoterBleoRSV40 poly(A) signalM13/pUC Reverselac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-markerCMV enhancerCMV promoter5' LTR (truncated)HIV-1 Psi
Basic Information
Name:
lenti-EF1a-dCas9-KRAB-Puro
Antibiotic Resistance:
Ampicillin
Length:
14337 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Selection Marker:
Puromycin, Zeocin
Copy Number:
High Copy
Promoter:
EF-1α
Cloning Method:
Gibson Cloning
5' Primer:
GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
3' Primer:
cacatagcgtaaaaggagcaacatag
$ 248.4
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

lenti-EF1a-dCas9-KRAB-Puro vector (Cat. No.: V000709) Sequence

LOCUS       V000709                14337 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000709
VERSION     V000709
KEYWORDS    lenti-EF1a-dCas9-KRAB-Puro
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 14337)
  AUTHORS   Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I,
            Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ
  TITLE     Evaluating Synthetic Activation and Repression of
            Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and
            Astrocytes.
  JOURNAL   Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi:
            10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27.
   PUBMED   28757163
REFERENCE   2  (bases 1 to 14337)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 14337)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1016/j.stemcr.2017.06.012"; journalName: "Stem Cell Reports";
            date: "2017-08-8- 8"; volume: "9"; issue: "2"; pages: "615-628"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..14337
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_feature    179..412
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             597..641
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             790..831
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    939..1056
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        1186..2364
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     CDS             2380..2427
                     /codon_start=1
                     /product="bipartite nuclear localization signal from
                     nucleoplasmin"
                     /label="nucleoplasmin NLS"
                     /translation="KRPAATKKAGQAKKKK"
     CDS             2428..6528
                     /label="dCas9"
                     /note="catalytically dead mutant of the Cas9 endonuclease
                     from the Streptococcus pyogenes Type II CRISPR/Cas system"
     CDS             6583..6603
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             6628..6822
                     /label="KRAB"
                     /note="Kruppel-associated box (KRAB) transcriptional
                     repression domain from the human zinc finger protein ZNF10
                     (Margolin et al., 1994)"
     CDS             6844..6897
                     /codon_start=1
                     /product="2A peptide from Thosea asigna virus capsid
                     protein"
                     /label="T2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="EGRGSLLTCGDVEENPGP"
     CDS             6910..7500
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    7528..8116
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(8119..8135)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(8120..8136)
                     /label="pBluescriptKS"
                     /note="For pBluescript vector"
     LTR             8641..8821
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     polyA_signal    8853..9077
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      9123..9551
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        9565..9894
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        9942..9989
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             10008..10379
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     polyA_signal    10512..10645
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(10682..10698)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(10682..10698)
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(10695..10717)
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     protein_bind    10706..10722
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(10730..10760)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(10775..10796)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(10913..10930)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(11084..11672)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(11846..12703)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(12704..12808)
                     /label="AmpR promoter"
     primer_bind     complement(12883..12902)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     enhancer        13074..13453
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        13454..13656
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             13671..13851
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    13898..14023
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"