lenti-EF1a-dCas9-KRAB-Puro vector (Cat. No.: V000709)
- Name:
- lenti-EF1a-dCas9-KRAB-Puro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 14337 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Puromycin, Zeocin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
- 3' Primer:
- cacatagcgtaaaaggagcaacatag
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
lenti-EF1a-dCas9-KRAB-Puro vector (Cat. No.: V000709) Sequence
LOCUS V000709 14337 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000709
VERSION V000709
KEYWORDS lenti-EF1a-dCas9-KRAB-Puro
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 14337)
AUTHORS Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I,
Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ
TITLE Evaluating Synthetic Activation and Repression of
Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and
Astrocytes.
JOURNAL Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi:
10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27.
PUBMED 28757163
REFERENCE 2 (bases 1 to 14337)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 14337)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1016/j.stemcr.2017.06.012"; journalName: "Stem Cell Reports";
date: "2017-08-8- 8"; volume: "9"; issue: "2"; pages: "615-628"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..14337
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 179..412
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 597..641
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 790..831
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 939..1056
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 1186..2364
/label="EF-1-alpha promoter"
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
CDS 2380..2427
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label="nucleoplasmin NLS"
/translation="KRPAATKKAGQAKKKK"
CDS 2428..6528
/label="dCas9"
/note="catalytically dead mutant of the Cas9 endonuclease
from the Streptococcus pyogenes Type II CRISPR/Cas system"
CDS 6583..6603
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 6628..6822
/label="KRAB"
/note="Kruppel-associated box (KRAB) transcriptional
repression domain from the human zinc finger protein ZNF10
(Margolin et al., 1994)"
CDS 6844..6897
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 6910..7500
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature 7528..8116
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(8119..8135)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8120..8136)
/label="pBluescriptKS"
/note="For pBluescript vector"
LTR 8641..8821
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 8853..9077
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 9123..9551
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 9565..9894
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 9942..9989
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 10008..10379
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 10512..10645
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(10682..10698)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(10682..10698)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(10695..10717)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 10706..10722
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(10730..10760)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(10775..10796)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(10913..10930)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(11084..11672)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(11846..12703)
/label="AmpR"
/note="beta-lactamase"
promoter complement(12704..12808)
/label="AmpR promoter"
primer_bind complement(12883..12902)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 13074..13453
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 13454..13656
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 13671..13851
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 13898..14023
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"