Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V000725 | pHAGE EF1α dCas9-VP64 | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pHAGE EF1α dCas9-VP64
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12794 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Gateway Cloning
- 5' Primer:
- AGAGCTCGTTTAGTGAACCG
- 3' Primer:
- MSCV-rev
pHAGE EF1α dCas9-VP64 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pHAGE EF1α dCas9-VP64 vector Sequence
LOCUS V000725 12794 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000725
VERSION V000725
KEYWORDS pHAGE EF1-alpha dCas9-VP64
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12794)
AUTHORS Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R
TITLE Cas9 effector-mediated regulation of transcription and
differentiation in human pluripotent stem cells.
JOURNAL Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
PUBMED 24346702
REFERENCE 2 (bases 1 to 12794)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12794)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1242/dev";
journalName: "Development"; date: "2014-01"; volume: "141"; issue:
"1"; pages: "219-23"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12794
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS 67..93
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
promoter 126..625
/label="PGK promoter"
/note="mouse phosphoglycerate kinase 1 promoter"
CDS 646..1242
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature 1262..1850
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 1925..2158
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
primer_bind complement(2277..2295)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 2363..2467
/label="AmpR promoter"
CDS 2468..3325
/label="AmpR"
/note="beta-lactamase"
rep_origin 3499..4087
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 4241..4258
/label="L4440"
/note="L4440 vector, forward primer"
primer_bind 4350..4369
/label="SV40pro-F"
/note="SV40 promoter/origin, forward primer"
protein_bind 4498..4519
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 4534..4564
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 4572..4588
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 4577..4599
/label="M13/pUC Reverse"
/note="In lacZ gene"
primer_bind 4596..4612
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind 4596..4612
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind 4662..4681
/label="EBV-rev"
/note="SV40 polyA terminator, reverse primer"
LTR 4873..5506
/label="3' LTR"
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 5553..5678
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 6175..6408
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 6593..6637
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 6786..6827
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 6930..7047
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 7093..8271
/label="EF-1-alpha promoter"
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
protein_bind 8306..8330
/gene="mutant version of attB"
/label="attB1"
/bound_moiety="BP Clonase(TM)"
/note="recombination site for the Gateway(R) BP reaction"
CDS 8340..12443
/label="dCas9"
/note="catalytically dead mutant of the Cas9 endonuclease
from the Streptococcus pyogenes Type II CRISPR/Cas system"
CDS 12456..12476
/codon_start=1
/product="nuclear localization signal of SV40 (simian virus
40) large T antigen"
/label="SV40 NLS"
/translation="PKKKRKV"
CDS 12477..12566
/label="3xHA"
/note="three tandem HA epitope tags"
CDS 12588..12737
/label="VP64"
/note="tetrameric repeat of the minimal activation domain
of herpes simplex virus VP16 (Beerli et al., 1998)"