Basic Vector Information
- Vector Name:
- LentiCRISPRv2GFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 13131 bp
- Type:
- Lentiviral, CRISPR
- Replication origin:
- ori
- Promoter:
- SV40
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- ATGGTGTCTAAGGGCGAAGA
LentiCRISPRv2GFP vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
LentiCRISPRv2GFP vector Sequence
LOCUS LentiCRISPRv2GFP 13131 bp DNA circular SYN 13-MAY-2021
DEFINITION 3rd generation lentiviral vector expressing GFP alongside Cas9 and
an sgRNA cloning site.
ACCESSION .
VERSION .
KEYWORDS LentiCRISPRv2GFP.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 13131)
AUTHORS Walter DM, Venancio OS, Buza EL, Tobias JW, Deshpande C, Gudiel AA,
Kim-Kiselak C, Cicchini M, Yates TJ, Feldser DM
TITLE Systematic in vivo inactivation of chromatin regulating enzymes
identifies Setd2 as a potent tumor suppressor in lung
adenocarcinoma.
JOURNAL Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi:
10.1158/0008-5472.CAN-16-2159.
PUBMED 28202515
REFERENCE 2 (bases 1 to 13131)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 13131)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cancer Res.
2017 Feb 15. pii: canres.2159.2016. doi:
10.1158/0008-5472.CAN-16-2159."
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..13131
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 1..241
/label=U6 promoter
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 266..341
/label=gRNA scaffold
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
promoter 403..614
/label=EF-1-alpha core promoter
/note="core promoter for human elongation factor
EF-1-alpha"
CDS 639..4742
/label=Cas9
/note="Cas9 (Csn1) endonuclease from the Streptococcus
pyogenes Type II CRISPR/Cas system"
CDS 4743..4790
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label=nucleoplasmin NLS
/translation="KRPAATKKAGQAKKKK"
CDS 4791..4814
/label=FLAG
/note="FLAG(R) epitope tag, followed by an enterokinase
cleavage site"
CDS 4824..4880
/codon_start=1
/product="2A peptide from porcine teschovirus-1
polyprotein"
/label=P2A
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="ATNFSLLKQAGDVEENPGP"
CDS 4881..5597
/label=EGFP
/note="enhanced GFP"
misc_feature 5616..6204
/label=WPRE
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 6276..6509
/label=3' LTR (Delta-U3)
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 6541..6765
/label=bGH poly(A) signal
/note="bovine growth hormone polyadenylation signal"
rep_origin 6811..7239
/label=f1 ori
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 7253..7582
/label=SV40 promoter
/note="SV40 enhancer and early promoter"
promoter 7630..7677
/label=EM7 promoter
/note="synthetic bacterial promoter"
CDS 7696..8067
/label=BleoR
/note="antibiotic-binding protein"
polyA_signal 8200..8333
/label=SV40 poly(A) signal
/note="SV40 polyadenylation signal"
primer_bind complement(8370..8386)
/label=M13 rev
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8370..8386)
/label=M13 Reverse
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(8383..8405)
/label=M13/pUC Reverse
/note="In lacZ gene"
protein_bind 8394..8410
/label=lac operator
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(8418..8448)
/label=lac promoter
/note="promoter for the E. coli lac operon"
protein_bind complement(8463..8484)
/label=CAP binding site
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(8601..8618)
/label=L4440
/note="L4440 vector, forward primer"
rep_origin complement(8772..9360)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(9534..10391)
/label=AmpR
/note="beta-lactamase"
promoter complement(10392..10496)
/label=AmpR promoter
primer_bind complement(10571..10590)
/label=pRS-marker
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 10762..11141
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 11142..11344
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 11359..11539
/label=5' LTR (truncated)
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 11586..11711
/label=HIV-1 Psi
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 12204..12437
/label=RRE
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 12622..12666
/label=gp41 peptide
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 12815..12856
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
misc_feature 12964..13081
/label=cPPT/CTS
/note="central polypurine tract and central termination
sequence of HIV-1"
This page is informational only.