phCMV-GALV-MTR vector (Cat. No.: V000819)

phCMV-GALV-MTR6825 bp3006009001200150018002100240027003000330036003900420045004800510054005700600063006600CMV enhancerCMV promoterbeta-globin intronenvBglob-pA-Rbeta-globin poly(A) signalM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterf1 oriM13 fwdT7 promoter
Basic Information

Note: phCMV-GALV-MTR, functioning as a retroviral packaging plasmid, drives GALV-MTR envelope protein expression via the CMV promoter to generate pseudotyped viruses. These efficiently infect primary human B cells to establish lymphoma models, enabling stable gene delivery and functional analysis.

Name:
phCMV-GALV-MTR
Antibiotic Resistance:
Ampicillin
Length:
6825 bp
Type:
Mammalian Expression
Replication origin:
ori
Promoter:
CMV
Cloning Method:
Gibson Cloning
5' Primer:
CTGGTCATCATCCTGCCTTT
3' Primer:
TTTTGGCAGAGGGAAAAAGA
Growth Strain(s):
DH10B
Growth Temperature:
37℃
$ 198.4
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Genetic modification of primary human B cells to model high-grade lymphoma. Nat Commun. 2019 Oct 4;10(1):4543.

phCMV-GALV-MTR vector (Cat. No.: V000819) Sequence

LOCUS       V000819                 6825 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000819
VERSION     V000819
KEYWORDS    phCMV-GALV-MTR
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 6825)
  AUTHORS   Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke
            SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park
            CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ
  TITLE     Genetic modification of primary human B cells to model high-grade
            lymphoma.
  JOURNAL   Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x.
   PUBMED   31586074
REFERENCE   2  (bases 1 to 6825)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6825)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nat
            Commun."; date: "2019-10-4"; pages: "
            10.1038/s41467-019-12494-x"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6825
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        86..465
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        466..669
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     primer_bind     666..690
                     /label="LNCX"
                     /note="Human CMV promoter, forward primer"
     intron          781..1353
                     /label="beta-globin intron"
                     /note="intron from rabbit beta-globin gene"
     CDS             1444..3483
                     /gene="env"
                     /label="Envelope glycoprotein"
                     /note="Envelope glycoprotein from Gibbon ape leukemia
                     virus. Accession#: P21415"
     primer_bind     complement(3519..3538)
                     /label="Bglob-pA-R"
                     /note="Rabbit beta-globin polyA region, reverse primer"
     polyA_signal    3584..3639
                     /label="beta-globin poly(A) signal"
                     /note="rabbit beta-globin polyadenylation signal (Gil and
                     Proudfoot, 1987)"
     primer_bind     complement(3638..3657)
                     /label="rbglobpA-R"
                     /note="Rabbit beta-globin polyA, reverse primer. Also
                     called rb-glob-pA-term-R"
     primer_bind     complement(3997..4013)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    complement(4021..4037)
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(4045..4075)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(4090..4111)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(4228..4245)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(4399..4987)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(5161..6018)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(6019..6123)
                     /label="AmpR promoter"
     rep_origin      complement(6149..6604)
                     /direction=LEFT
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     primer_bind     6746..6762
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        6772..6790
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"