phCMV-GALV-MTR vector (Cat. No.: V000819)
Note: phCMV-GALV-MTR, functioning as a retroviral packaging plasmid, drives GALV-MTR envelope protein expression via the CMV promoter to generate pseudotyped viruses. These efficiently infect primary human B cells to establish lymphoma models, enabling stable gene delivery and functional analysis.
- Name:
- phCMV-GALV-MTR
- Antibiotic Resistance:
- Ampicillin
- Length:
- 6825 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Promoter:
- CMV
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- CTGGTCATCATCCTGCCTTT
- 3' Primer:
- TTTTGGCAGAGGGAAAAAGA
- Growth Strain(s):
- DH10B
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ. Genetic modification of primary human B cells to model high-grade lymphoma. Nat Commun. 2019 Oct 4;10(1):4543.
phCMV-GALV-MTR vector (Cat. No.: V000819) Sequence
LOCUS V000819 6825 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000819
VERSION V000819
KEYWORDS phCMV-GALV-MTR
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 6825)
AUTHORS Caeser R, Di Re M, Krupka JA, Gao J, Lara-Chica M, Dias JML, Cooke
SL, Fenner R, Usheva Z, Runge HFP, Beer PA, Eldaly H, Pak HK, Park
CS, Vassiliou GS, Huntly BJP, Mupo A, Bashford-Rogers RJM, Hodson DJ
TITLE Genetic modification of primary human B cells to model high-grade
lymphoma.
JOURNAL Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x.
PUBMED 31586074
REFERENCE 2 (bases 1 to 6825)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 6825)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Commun."; date: "2019-10-4"; pages: "
10.1038/s41467-019-12494-x"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..6825
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 86..465
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 466..669
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
primer_bind 666..690
/label="LNCX"
/note="Human CMV promoter, forward primer"
intron 781..1353
/label="beta-globin intron"
/note="intron from rabbit beta-globin gene"
CDS 1444..3483
/gene="env"
/label="Envelope glycoprotein"
/note="Envelope glycoprotein from Gibbon ape leukemia
virus. Accession#: P21415"
primer_bind complement(3519..3538)
/label="Bglob-pA-R"
/note="Rabbit beta-globin polyA region, reverse primer"
polyA_signal 3584..3639
/label="beta-globin poly(A) signal"
/note="rabbit beta-globin polyadenylation signal (Gil and
Proudfoot, 1987)"
primer_bind complement(3638..3657)
/label="rbglobpA-R"
/note="Rabbit beta-globin polyA, reverse primer. Also
called rb-glob-pA-term-R"
primer_bind complement(3997..4013)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(4021..4037)
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(4045..4075)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(4090..4111)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(4228..4245)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(4399..4987)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(5161..6018)
/label="AmpR"
/note="beta-lactamase"
promoter complement(6019..6123)
/label="AmpR promoter"
rep_origin complement(6149..6604)
/direction=LEFT
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
primer_bind 6746..6762
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
promoter 6772..6790
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"