pXR001: EF1a-CasRx-2A-EGFP vector (V000855)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V000855 pXR001: EF1a-CasRx-2A-EGFP In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pXR001: EF1a-CasRx-2A-EGFP
Antibiotic Resistance:
Ampicillin
Length:
12991 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Selection Marker:
GFP
Copy Number:
High Copy
Promoter:
EF-1α
Cloning Method:
Gibson Cloning
5' Primer:
ggatcttggttcattctcaagcctc

pXR001: EF1a-CasRx-2A-EGFP vector Map

pXR001: EF1a-CasRx-2A-EGFP12991 bp6001200180024003000360042004800540060006600720078008400900096001020010800114001200012600cPPT/CTSEF-1-alpha promoterSV40 NLSRfxCas13dSV40 NLSHAT2AEGFPWPREKS primer5' LTR (truncated)bGH poly(A) signalf1 oriSV40 promoterEM7 promoterBleoRSV40 poly(A) signalIn lacZ genelac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-markerCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein Tat

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pXR001: EF1a-CasRx-2A-EGFP vector Sequence

LOCUS       V000855                12991 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000855
VERSION     V000855
KEYWORDS    pXR001: EF1a-CasRx-2A-EGFP
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12991)
  AUTHORS   Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD
  TITLE     Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR
            Effectors.
  JOURNAL   Cell. 2018 Mar 8. pii: S0092-8674(18)30207-1. doi:
            10.1016/j.cell.2018.02.033.
   PUBMED   29551272
REFERENCE   2  (bases 1 to 12991)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 12991)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2018
            Mar 8. pii: S0092-8674(18)30207-1. doi: 10.1016/j.cell.2018.02.033."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12991
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_feature    61..178
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        303..1481
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     CDS             1500..1520
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             1530..4427
                     /label="RfxCas13d"
                     /note="RNA-targeting Type VI CRISPR protein from
                     Ruminococcus flavefaciens strain XPD3002 (Konermann et al.,
                     2018)"
     CDS             4437..4457
                     /label="SV40 NLS"
                     /note="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
     CDS             4467..4493
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     CDS             4509..4562
                     /codon_start=1
                     /product="2A peptide from Thosea asigna virus capsid
                     protein"
                     /label="T2A"
                     /note="Eukaryotic ribosomes fail to insert a peptide bond
                     between the Gly and Pro residues, yielding separate
                     polypeptides."
                     /translation="EGRGSLLTCGDVEENPGP"
     CDS             4563..5276
                     /label="EGFP"
                     /note="enhanced GFP"
     misc_feature    5304..5892
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(5895..5911)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(5896..5912)
                     /label="pBluescriptKS"
                     /note="For pBluescript vector"
     LTR             6417..6597
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     polyA_signal    6629..6853
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      6899..7327
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        7341..7670
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        7718..7765
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             7784..8155
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     polyA_signal    8288..8421
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(8458..8474)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(8458..8474)
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(8471..8493)
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     protein_bind    8482..8498
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(8506..8536)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(8551..8572)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(8689..8706)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(8860..9448)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(9622..10479)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(10480..10584)
                     /label="AmpR promoter"
     primer_bind     complement(10659..10678)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     enhancer        10850..11229
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        11230..11432
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             11447..11627
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    11674..11799
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    12292..12525
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             12710..12754
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             12903..12944
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"