pLenti6/V5-GW/lacZ vector (Cat. No.: V000998)
Note: The pLenti6⁄V5-DEST Gateway Vector is a Gateway-adapted ViraPower lentiviral expression vector for lentiviral-based expression of a target gene in dividing and non-dividing mammalian cells. The vector has the CMV promoter for driving constitutive expression of the target gene and the blasticidin selection marker for stable selection in mammalian cells.Advantages • Lentivirus based expression of a target gene in dividing and non-dividing mammalian cellsKey Features • Flexible and versatile Gateway recombination cloning technology • Constitutive high expression with CMV promoter • Blasticidin selection marker for stable selection • C terminal V5 tag for quick detection
- Name:
- pLenti6/V5-GW/lacZ
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10127 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Selection Marker:
- Blasticidin
- Promoter:
- RSV
- Cloning Method:
- Gateway
- 5' Primer:
- CMVPro Fwd: 5'd[CGCAAATGGGCGGTAGGCGTG]3'
- Fusion Tag:
- V5
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLenti6/V5-GW/lacZ vector (Cat. No.: V000998) Sequence
LOCUS V000998 10127 bp DNA circular SYN 13-JAN-2022
DEFINITION Exported.
ACCESSION V000998
VERSION V000998
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10127)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 10127)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10127
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 3..229
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 230..410
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 457..582
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1075..1308
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1493..1537
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1686..1727
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
enhancer 1816..2119
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 2120..2323
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
protein_bind 2440..2464
/label="attB1"
/note="recombination site for the Gateway(R) BP reaction"
CDS 2496..5540
/label="lacZ"
/note="beta-galactosidase"
protein_bind complement(5560..5584)
/label="attB2"
/note="recombination site for the Gateway(R) BP reaction"
CDS 5637..5678
/label="V5 tag"
/note="epitope tag from simian virus 5"
promoter 5720..6049
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 6097..6144
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 6163..6558
/label="BSD"
/note="blasticidin S deaminase"
LTR 6648..6881
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 6953..7087
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 7114..7249
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(7270..7288)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(7298..7314)
/label="M13 fwd"
/note="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 7456..7911
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 7937..8041
/label="AmpR promoter"
CDS 8042..8899
/label="AmpR"
/note="beta-lactamase"
rep_origin 9073..9661
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
protein_bind 9949..9970
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 9985..10015
/note="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 10023..10039
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 10047..10063
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
promoter 10084..10102
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"