pLenti6/V5-GW/lacZ vector (Cat. No.: V000998)

pLenti6/V5-GW/lacZ10127 bp50010001500200025003000350040004500500055006000650070007500800085009000950010000RSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatCMV enhancerCMV promoterattB1lacZattB2V5 tagSV40 promoterEM7 promoterBSD3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriT7 promoterM13 fwdf1 oriAmpR promoterAmpRoriCAP binding sitelac promoterlac operatorM13 revT3 promoter
Basic Information

Note: The pLenti6⁄V5-DEST Gateway Vector is a Gateway-adapted ViraPower lentiviral expression vector for lentiviral-based expression of a target gene in dividing and non-dividing mammalian cells. The vector has the CMV promoter for driving constitutive expression of the target gene and the blasticidin selection marker for stable selection in mammalian cells.Advantages • Lentivirus based expression of a target gene in dividing and non-dividing mammalian cellsKey Features • Flexible and versatile Gateway recombination cloning technology • Constitutive high expression with CMV promoter • Blasticidin selection marker for stable selection • C terminal V5 tag for quick detection

Name:
pLenti6/V5-GW/lacZ
Antibiotic Resistance:
Ampicillin
Length:
10127 bp
Type:
Lentiviral vectors
Replication origin:
ori
Selection Marker:
Blasticidin
Promoter:
RSV
Cloning Method:
Gateway
5' Primer:
CMVPro Fwd: 5'd[CGCAAATGGGCGGTAGGCGTG]3'
Fusion Tag:
V5
$ 198.5
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLenti6/V5-GW/lacZ vector (Cat. No.: V000998) Sequence

LOCUS       V000998                10127 bp    DNA     circular SYN 13-JAN-2022
DEFINITION  Exported.
ACCESSION   V000998
VERSION     V000998
KEYWORDS    .
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 10127)
  TITLE     Direct Submission
REFERENCE   2  (bases 1 to 10127)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10127
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        3..229
                     /label="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             230..410
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    457..582
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1075..1308
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1493..1537
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             1686..1727
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     enhancer        1816..2119
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        2120..2323
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     protein_bind    2440..2464
                     /label="attB1"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             2496..5540
                     /label="lacZ"
                     /note="beta-galactosidase"
     protein_bind    complement(5560..5584)
                     /label="attB2"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             5637..5678
                     /label="V5 tag"
                     /note="epitope tag from simian virus 5"
     promoter        5720..6049
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        6097..6144
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             6163..6558
                     /label="BSD"
                     /note="blasticidin S deaminase"
     LTR             6648..6881
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    6953..7087
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      7114..7249
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     promoter        complement(7270..7288)
                     /label="T7 promoter"
                     /note="promoter for bacteriophage T7 RNA polymerase"
     primer_bind     complement(7298..7314)
                     /label="M13 fwd"
                     /note="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     rep_origin      7456..7911
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        7937..8041
                     /label="AmpR promoter"
     CDS             8042..8899
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      9073..9661
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     protein_bind    9949..9970
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        9985..10015
                     /note="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    10023..10039
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     10047..10063
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     promoter        10084..10102
                     /label="T3 promoter"
                     /note="promoter for bacteriophage T3 RNA polymerase"