Basic Vector Information
- Vector Name:
- pMKV057
- Antibiotic Resistance:
- Kanamycin
- Length:
- 15986 bp
- Type:
- Plant Expression
- Replication origin:
- ori
- Host:
- Plants
- Copy Number:
- High Copy
- Promoter:
- CaMV35S(short)
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- taccctccgcgagatcatcc
- 3' Primer:
- aacgtcagaagccgactgc
pMKV057 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
pMKV057 vector Sequence
LOCUS pMKV057. 15986 bp DNA circular SYN 13-MAY-2021
DEFINITION BeYDV viral replicon on T-DNA backbone expressing Firefly Luc+, WUS2
and IPT.
ACCESSION .
VERSION .
KEYWORDS pMKV057.
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 15986)
AUTHORS Maher MF, Nasti RA, Vollbrecht M, Starker CG, Clark MD, Voytas DF
TITLE Plant gene editing through de novo induction of meristems.
JOURNAL Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi:
10.1038/s41587-019-0337-2.
PUBMED 31844292
REFERENCE 2 (bases 1 to 15986)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 15986)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi:
10.1038/s41587-019-0337-2."
COMMENT SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..15986
/mol_type="other DNA"
/organism="synthetic DNA construct"
CDS complement(419..1294)
/note="Replication-associated protein A from Bean yellow
dwarf virus. Accession#: O39521"
misc_feature 1668..1692
/label=RB T-DNA repeat
/note="right border repeat from nopaline C58 T-DNA"
CDS 2993..3619
/label=pVS1 StaA
/note="stability protein from the Pseudomonas plasmid pVS1
(Heeb et al., 2000)"
CDS 4051..5121
/label=pVS1 RepA
/note="replication protein from the Pseudomonas plasmid
pVS1 (Heeb et al., 2000)"
rep_origin 5190..5384
/label=pVS1 oriV
/note="origin of replication for the Pseudomonas plasmid
pVS1 (Heeb et al., 2000)"
primer_bind complement(5620..5642)
/label=pGEX 3'
/note="pGEX vectors, reverse primer"
misc_feature 5728..5868
/label=bom
/note="basis of mobility region from pBR322"
primer_bind complement(5883..5900)
/label=L4440
/note="L4440 vector, forward primer"
rep_origin complement(6054..6642)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6732..7523)
/label=KanR
/note="aminoglycoside phosphotransferase"
misc_feature 7948..7972
/label=LB T-DNA repeat
/note="left border repeat from nopaline C58 T-DNA"
CDS 9810..11459
/label=luciferase
/note="firefly luciferase"
promoter 11911..12094
/label=NOS promoter
/note="nopaline synthase promoter"
promoter 14350..14695
/label=CaMV 35S promoter
/note="strong constitutive promoter from cauliflower mosaic
virus"
This page is informational only.