Cre-IRES-PuroR vector (Cat. No.: V001194)

Cre-IRES-PuroR9229 bp400800120016002000240028003200360040004400480052005600600064006800720076008000840088009200EBV-rev3' LTRHIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSEF-1-alpha promoterKozak sequenceCreIRES2PuroRWPRE5' LTR (truncated)pBRforEcoAmpR promoterAmpRoriL4440SV40pro-FCAP binding sitelac promoterlac operator
Basic Information
Name:
Cre-IRES-PuroR
Antibiotic Resistance:
Ampicillin
Length:
9229 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
EF-1α
Cloning Method:
Restriction Enzyme
5' Primer:
GGTTCATTCTCAAGCCTCAGACAGTG
$ 199.1
In stock, 1 week for quality controls
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

Cre-IRES-PuroR vector (Cat. No.: V001194) Sequence

LOCUS       V001194                 9229 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001194
VERSION     V001194
KEYWORDS    Cre-IRES-PuroR
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9229)
  AUTHORS   Somers A, Jean JC, Sommer CA, Omari A, Ford CC, Mills JA, Ying L,
            Sommer AG, Jean JM, Smith BW, Lafyatis R, Demierre MF, Weiss DJ,
            French DL, Gadue P, Murphy GJ, Mostoslavsky G, Kotton DN
  TITLE     Generation of transgene-free lung disease-specific human induced
            pluripotent stem cells using a single excisable lentiviral stem cell
            cassette.
  JOURNAL   Stem Cells. 2010 Oct . 28(10):1728-40.
   PUBMED   20715179
REFERENCE   2  (bases 1 to 9229)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9229)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Stem Cells.
            2010 Oct . 28(10):1728-40."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9229
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     primer_bind     55..74
                     /label="EBV-rev"
                     /note="SV40 polyA terminator, reverse primer"
     LTR             266..899
                     /label="3' LTR"
                     /note="3' long terminal repeat (LTR) from HIV-1"
     misc_feature    946..1071
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1568..1801
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1986..2030
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2179..2220
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2323..2440
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2488..3666
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     regulatory      3671..3680
                     /label="Kozak sequence"
                     /note="vertebrate consensus sequence for strong initiation
                     of translation (Kozak, 1987)"
                     /regulatory_class="other"
     CDS             3707..4735
                     /label="Cre"
                     /note="site-specific recombinase"
     misc_feature    4741..5319
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             5323..5919
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    5936..6524
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             6672..6852
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     primer_bind     complement(6899..6917)
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"
     promoter        6985..7089
                     /label="AmpR promoter"
     CDS             7090..7947
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      8121..8709
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     8863..8880
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     primer_bind     8972..8991
                     /label="SV40pro-F"
                     /note="SV40 promoter/origin, forward primer"
     protein_bind    9120..9141
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        9156..9186
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    9194..9210
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."